ID: 1181318838

View in Genome Browser
Species Human (GRCh38)
Location 22:21989269-21989291
Sequence ATGTCTTTCCAGCAGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181318838_1181318844 9 Left 1181318838 22:21989269-21989291 CCCTGACACTGCTGGAAAGACAT No data
Right 1181318844 22:21989301-21989323 AGGTACCTACAGGAAGCAATGGG No data
1181318838_1181318843 8 Left 1181318838 22:21989269-21989291 CCCTGACACTGCTGGAAAGACAT No data
Right 1181318843 22:21989300-21989322 AAGGTACCTACAGGAAGCAATGG No data
1181318838_1181318841 -1 Left 1181318838 22:21989269-21989291 CCCTGACACTGCTGGAAAGACAT No data
Right 1181318841 22:21989291-21989313 TGTCACCAGAAGGTACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181318838 Original CRISPR ATGTCTTTCCAGCAGTGTCA GGG (reversed) Intergenic
No off target data available for this crispr