ID: 1181322762

View in Genome Browser
Species Human (GRCh38)
Location 22:22021292-22021314
Sequence GCTGGTATGGAGACCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181322744_1181322762 28 Left 1181322744 22:22021241-22021263 CCACCCTGACTTCCAGTTGAATC No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322754_1181322762 -1 Left 1181322754 22:22021270-22021292 CCCCCCAACAGACAGAGGGGGAG No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322756_1181322762 -3 Left 1181322756 22:22021272-22021294 CCCCAACAGACAGAGGGGGAGCT No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322745_1181322762 25 Left 1181322745 22:22021244-22021266 CCCTGACTTCCAGTTGAATCCCA No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322748_1181322762 6 Left 1181322748 22:22021263-22021285 CCCATCTCCCCCCAACAGACAGA No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322758_1181322762 -5 Left 1181322758 22:22021274-22021296 CCAACAGACAGAGGGGGAGCTGG No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322746_1181322762 24 Left 1181322746 22:22021245-22021267 CCTGACTTCCAGTTGAATCCCAT No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322747_1181322762 16 Left 1181322747 22:22021253-22021275 CCAGTTGAATCCCATCTCCCCCC No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322757_1181322762 -4 Left 1181322757 22:22021273-22021295 CCCAACAGACAGAGGGGGAGCTG No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322755_1181322762 -2 Left 1181322755 22:22021271-22021293 CCCCCAACAGACAGAGGGGGAGC No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data
1181322749_1181322762 5 Left 1181322749 22:22021264-22021286 CCATCTCCCCCCAACAGACAGAG No data
Right 1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181322762 Original CRISPR GCTGGTATGGAGACCATGGA AGG Intergenic
No off target data available for this crispr