ID: 1181323007

View in Genome Browser
Species Human (GRCh38)
Location 22:22023072-22023094
Sequence GAAGAACACAAGATCCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181323004_1181323007 10 Left 1181323004 22:22023039-22023061 CCACTGAGCAGGAGCTGAGAGGG No data
Right 1181323007 22:22023072-22023094 GAAGAACACAAGATCCATATGGG No data
1181323001_1181323007 25 Left 1181323001 22:22023024-22023046 CCAAATCTGCTTCAGCCACTGAG No data
Right 1181323007 22:22023072-22023094 GAAGAACACAAGATCCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181323007 Original CRISPR GAAGAACACAAGATCCATAT GGG Intergenic
No off target data available for this crispr