ID: 1181323552

View in Genome Browser
Species Human (GRCh38)
Location 22:22026661-22026683
Sequence CTGATCGTACAGTTTAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181323546_1181323552 15 Left 1181323546 22:22026623-22026645 CCATACTTGCCTATGACAAACAA No data
Right 1181323552 22:22026661-22026683 CTGATCGTACAGTTTAAGCAAGG No data
1181323549_1181323552 6 Left 1181323549 22:22026632-22026654 CCTATGACAAACAAAGAGGGTGC No data
Right 1181323552 22:22026661-22026683 CTGATCGTACAGTTTAAGCAAGG No data
1181323545_1181323552 30 Left 1181323545 22:22026608-22026630 CCGAGGCTGATCACTCCATACTT No data
Right 1181323552 22:22026661-22026683 CTGATCGTACAGTTTAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181323552 Original CRISPR CTGATCGTACAGTTTAAGCA AGG Intergenic
No off target data available for this crispr