ID: 1181324926

View in Genome Browser
Species Human (GRCh38)
Location 22:22037328-22037350
Sequence CTCTCTAAAGGGGAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181324919_1181324926 -9 Left 1181324919 22:22037314-22037336 CCAGAGAACAGCTCCTCTCTAAA No data
Right 1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG No data
1181324916_1181324926 26 Left 1181324916 22:22037279-22037301 CCACCATCATAGGCATACATTTC No data
Right 1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG No data
1181324917_1181324926 23 Left 1181324917 22:22037282-22037304 CCATCATAGGCATACATTTCTGA No data
Right 1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG No data
1181324918_1181324926 -8 Left 1181324918 22:22037313-22037335 CCCAGAGAACAGCTCCTCTCTAA No data
Right 1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181324926 Original CRISPR CTCTCTAAAGGGGAGGTGTA GGG Intergenic
No off target data available for this crispr