ID: 1181327544

View in Genome Browser
Species Human (GRCh38)
Location 22:22061359-22061381
Sequence CTTTCGGCAGCAGCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181327537_1181327544 27 Left 1181327537 22:22061309-22061331 CCAAGCTCGCCCACACTCAGCAG No data
Right 1181327544 22:22061359-22061381 CTTTCGGCAGCAGCCAGGGAAGG No data
1181327538_1181327544 18 Left 1181327538 22:22061318-22061340 CCCACACTCAGCAGTCAGCATAG No data
Right 1181327544 22:22061359-22061381 CTTTCGGCAGCAGCCAGGGAAGG No data
1181327539_1181327544 17 Left 1181327539 22:22061319-22061341 CCACACTCAGCAGTCAGCATAGC No data
Right 1181327544 22:22061359-22061381 CTTTCGGCAGCAGCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181327544 Original CRISPR CTTTCGGCAGCAGCCAGGGA AGG Intergenic
No off target data available for this crispr