ID: 1181328266

View in Genome Browser
Species Human (GRCh38)
Location 22:22068306-22068328
Sequence GTGCAATCCCACAGTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181328266_1181328267 30 Left 1181328266 22:22068306-22068328 CCACAGAAACTGTGGGATTGCAC No data
Right 1181328267 22:22068359-22068381 TGATGTGAAGTAATTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181328266 Original CRISPR GTGCAATCCCACAGTTTCTG TGG (reversed) Intergenic