ID: 1181329296

View in Genome Browser
Species Human (GRCh38)
Location 22:22076728-22076750
Sequence CTTTCCTGCACCTGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181329291_1181329296 -7 Left 1181329291 22:22076712-22076734 CCTCCCTGAAGAATGACTTTCCT No data
Right 1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG No data
1181329292_1181329296 -10 Left 1181329292 22:22076715-22076737 CCCTGAAGAATGACTTTCCTGCA No data
Right 1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG No data
1181329290_1181329296 26 Left 1181329290 22:22076679-22076701 CCACTGGCTCTTACACACTTGGA No data
Right 1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181329296 Original CRISPR CTTTCCTGCACCTGGGCTGA AGG Intergenic
No off target data available for this crispr