ID: 1181335938 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:22128472-22128494 |
Sequence | ACAGTTCTTGGGGTTCCAAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181335938_1181335943 | 7 | Left | 1181335938 | 22:22128472-22128494 | CCTCTTGGAACCCCAAGAACTGT | No data | ||
Right | 1181335943 | 22:22128502-22128524 | CAGGTCCATCTCAAAATCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181335938 | Original CRISPR | ACAGTTCTTGGGGTTCCAAG AGG (reversed) | Intergenic | ||