ID: 1181335938

View in Genome Browser
Species Human (GRCh38)
Location 22:22128472-22128494
Sequence ACAGTTCTTGGGGTTCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181335938_1181335943 7 Left 1181335938 22:22128472-22128494 CCTCTTGGAACCCCAAGAACTGT No data
Right 1181335943 22:22128502-22128524 CAGGTCCATCTCAAAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181335938 Original CRISPR ACAGTTCTTGGGGTTCCAAG AGG (reversed) Intergenic