ID: 1181345179

View in Genome Browser
Species Human (GRCh38)
Location 22:22214852-22214874
Sequence GGTGAGAGTGGACCTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181345171_1181345179 18 Left 1181345171 22:22214811-22214833 CCTGGGCTCTGCTCCTCCTGACC No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345176_1181345179 -4 Left 1181345176 22:22214833-22214855 CCTCCTCACTCACTCTGCAGGTG No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345175_1181345179 -3 Left 1181345175 22:22214832-22214854 CCCTCCTCACTCACTCTGCAGGT No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345170_1181345179 19 Left 1181345170 22:22214810-22214832 CCCTGGGCTCTGCTCCTCCTGAC No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345173_1181345179 2 Left 1181345173 22:22214827-22214849 CCTGACCCTCCTCACTCACTCTG No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345172_1181345179 5 Left 1181345172 22:22214824-22214846 CCTCCTGACCCTCCTCACTCACT No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345177_1181345179 -7 Left 1181345177 22:22214836-22214858 CCTCACTCACTCTGCAGGTGAGA No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data
1181345169_1181345179 24 Left 1181345169 22:22214805-22214827 CCATGCCCTGGGCTCTGCTCCTC No data
Right 1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181345179 Original CRISPR GGTGAGAGTGGACCTTACCC AGG Intergenic
No off target data available for this crispr