ID: 1181346109

View in Genome Browser
Species Human (GRCh38)
Location 22:22221722-22221744
Sequence GTGCAGAAGCATAGTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181346107_1181346109 -5 Left 1181346107 22:22221704-22221726 CCTGTGGCTGAAAGCGCAGTGCA No data
Right 1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG No data
1181346106_1181346109 -1 Left 1181346106 22:22221700-22221722 CCTGCCTGTGGCTGAAAGCGCAG No data
Right 1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG No data
1181346105_1181346109 0 Left 1181346105 22:22221699-22221721 CCCTGCCTGTGGCTGAAAGCGCA No data
Right 1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181346109 Original CRISPR GTGCAGAAGCATAGTAAGGA AGG Intergenic
No off target data available for this crispr