ID: 1181346563

View in Genome Browser
Species Human (GRCh38)
Location 22:22223805-22223827
Sequence CAGGAGCCGAAACATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181346563_1181346571 29 Left 1181346563 22:22223805-22223827 CCTTGCTCATGTTTCGGCTCCTG No data
Right 1181346571 22:22223857-22223879 TGAAACCTCCTCAACTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181346563 Original CRISPR CAGGAGCCGAAACATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr