ID: 1181346685

View in Genome Browser
Species Human (GRCh38)
Location 22:22224374-22224396
Sequence GAGGGTGGCACCACTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181346679_1181346685 21 Left 1181346679 22:22224330-22224352 CCTGAGGGTGGACTAGGGTTGCC 0: 2
1: 0
2: 2
3: 8
4: 92
Right 1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG No data
1181346675_1181346685 28 Left 1181346675 22:22224323-22224345 CCCAGGTCCTGAGGGTGGACTAG 0: 2
1: 0
2: 0
3: 15
4: 140
Right 1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG No data
1181346676_1181346685 27 Left 1181346676 22:22224324-22224346 CCAGGTCCTGAGGGTGGACTAGG No data
Right 1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG No data
1181346680_1181346685 0 Left 1181346680 22:22224351-22224373 CCTGCTCGATTCTGACACAGAGA No data
Right 1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181346685 Original CRISPR GAGGGTGGCACCACTGGCTG AGG Intergenic
No off target data available for this crispr