ID: 1181347814

View in Genome Browser
Species Human (GRCh38)
Location 22:22233126-22233148
Sequence CCCCTGTAGGATCATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181347814_1181347819 -4 Left 1181347814 22:22233126-22233148 CCATCACCATGATCCTACAGGGG No data
Right 1181347819 22:22233145-22233167 GGGGGCATCCCCCTTAGTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181347814 Original CRISPR CCCCTGTAGGATCATGGTGA TGG (reversed) Intergenic
No off target data available for this crispr