ID: 1181349447

View in Genome Browser
Species Human (GRCh38)
Location 22:22244729-22244751
Sequence CAGAGCAGGGAGGAGGATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1107
Summary {0: 1, 1: 0, 2: 13, 3: 96, 4: 997}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181349437_1181349447 9 Left 1181349437 22:22244697-22244719 CCAGGAACGGGGTGTGCCACGGC 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG 0: 1
1: 0
2: 13
3: 96
4: 997
1181349438_1181349447 -7 Left 1181349438 22:22244713-22244735 CCACGGCCCCACCTCTCAGAGCA 0: 1
1: 1
2: 1
3: 35
4: 351
Right 1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG 0: 1
1: 0
2: 13
3: 96
4: 997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181349447 Original CRISPR CAGAGCAGGGAGGAGGATGC TGG Exonic
900227703 1:1540650-1540672 GGGAGGAGGGAGGAGGAGGCAGG - Intergenic
900414287 1:2527979-2528001 CTGAGCAGGAAGGAGCAGGCAGG + Intergenic
900484441 1:2914750-2914772 CAGAGCAGGATGGGGGAAGCTGG + Intergenic
900546723 1:3233553-3233575 AGGGGCAGGGAGAAGGATGCTGG - Intronic
900708204 1:4093939-4093961 CAGAGAAGGAAGGTGGGTGCTGG - Intergenic
900905622 1:5555062-5555084 CCGAGCTGGGGAGAGGATGCTGG - Intergenic
900936244 1:5768035-5768057 CAGCCCAGGGATGAGGGTGCTGG - Intergenic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
901157995 1:7153637-7153659 AAGAGCAGGTGGGAGGTTGCCGG - Intronic
901396971 1:8988694-8988716 CTGTCCAGGGAGAAGGATGCAGG + Intergenic
901441061 1:9278783-9278805 TGGAGGAGGGAGGAGGCTGCTGG - Intergenic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
902350118 1:15847982-15848004 CAGCGCCGGGAGGCGGGTGCCGG - Exonic
902648233 1:17819054-17819076 CTGACCTGGGAGGAGGAGGCTGG - Intronic
903120735 1:21215496-21215518 CAGAGCGGGGAAGAGGAAGGAGG + Intergenic
903222738 1:21878117-21878139 CACAGCTGGGAGGAGGAAGAAGG - Intronic
903305226 1:22408484-22408506 CATAGCTGGGAGCAGGATTCAGG + Intergenic
903321108 1:22543676-22543698 CAGAGCTGGTGGGAGGATGGAGG - Intergenic
903332321 1:22602447-22602469 GAGAGCCGGGTGGAGGCTGCAGG - Exonic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903455626 1:23484617-23484639 CAGAGGAGGGAGGAAGAGGGAGG - Intergenic
903471460 1:23590550-23590572 AGAAGCAGGGAGGAGGAGGCGGG + Intronic
903603065 1:24556162-24556184 CAGAGCAGGTAGGAGGCGCCTGG + Exonic
903708319 1:25303208-25303230 CAAAGCAGGGAGGATGTTACAGG + Intronic
903718795 1:25389205-25389227 CAAAGCAGGGAGGATGTTACAGG - Intronic
903857139 1:26344100-26344122 CAGCGCAGGCAGGAGAAAGCTGG - Exonic
904190298 1:28737707-28737729 CTGAGCCGGGAGGGGGACGCGGG + Intronic
904260177 1:29283580-29283602 CAGAGGAGGGAGGAGCCTGGAGG - Intronic
904484444 1:30815496-30815518 CAGAGCAGGAAGGAGAACGTAGG - Intergenic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
904646655 1:31972594-31972616 AAGAGCAGTGAGGAGGCTGTTGG + Intergenic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
904880945 1:33696493-33696515 CATGGCAGGGAGTAGGGTGCTGG + Intronic
904928366 1:34066348-34066370 CAAGGCAGAGAGGGGGATGCAGG - Intronic
905387116 1:37612834-37612856 GAGAGCAAGGAGGCGGGTGCTGG - Exonic
905656199 1:39687553-39687575 CAGAGCAGGGAGGAGAAAAGGGG - Intronic
905975488 1:42171039-42171061 CAAAGCAGGCTGGGGGATGCGGG - Intergenic
906040477 1:42784920-42784942 CAGAGCAGGGGAGGGGTTGCGGG - Intronic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
907637670 1:56152543-56152565 AGGAGAATGGAGGAGGATGCTGG + Intergenic
907701317 1:56791037-56791059 CAAAGCAGGGACCAGCATGCAGG + Intronic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
908738960 1:67307812-67307834 CAGAGGCGGGAGGCGGAGGCGGG + Exonic
908837841 1:68245826-68245848 CAGAGCAGTCAGTAGAATGCTGG - Intergenic
911688641 1:100806198-100806220 CAGAGCAGAGGGGAGTCTGCAGG + Intergenic
912197752 1:107419222-107419244 GAGAGGAGGGAGGAGGTAGCGGG - Intronic
912255890 1:108057780-108057802 AACAGCAGAGAGGAGGAGGCAGG - Intergenic
912390350 1:109298310-109298332 CACAGCAGGCAGCTGGATGCAGG - Intronic
912410639 1:109478575-109478597 CAGAGCAGGGCTGAGGTGGCTGG - Intronic
912414431 1:109498410-109498432 CAGAGCAGAGAGGAGGGCACTGG + Intronic
912747813 1:112260193-112260215 CAGAGCAGGGTGGAGAAGGGTGG - Intergenic
912842856 1:113053933-113053955 CAGAGCTGTGGTGAGGATGCTGG + Intergenic
913045341 1:115069188-115069210 AAGAGCAAGCAGGAGGATTCAGG + Intronic
913141193 1:115942933-115942955 CAGCCAAGGGAGGAGGGTGCTGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913272872 1:117111311-117111333 CAGAGCTGTGAGAAGGATGAAGG + Exonic
913692181 1:121289554-121289576 CAGTGCAGGGGGGAGGCTGAAGG + Intronic
914063829 1:144229018-144229040 CAGGGCAGGGAGCAGGGTACAGG - Intergenic
914115321 1:144737336-144737358 CAGGGCAGGGAGCAGGGTACAGG + Intergenic
914145374 1:144990560-144990582 CAGTGCAGGGGGGAGGCTGAAGG - Intronic
914419980 1:147520255-147520277 CCAATCAGGGAGGAGGCTGCTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915108364 1:153547974-153547996 CAGAGCAGGGAGGTTGAAGTCGG - Intronic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915730049 1:158046893-158046915 CAGAGCATGGAGGGGGTTGCTGG + Intronic
915970796 1:160353701-160353723 CAGAGCAGGGATGATGCTGAAGG - Intronic
916003372 1:160637259-160637281 GAAAGCAGGAAGGAGGATGAGGG - Exonic
916193676 1:162203393-162203415 CAGAGCTGGGATTAGGAAGCAGG + Intronic
916211583 1:162364209-162364231 GAGAGGTGGGACGAGGATGCAGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918246539 1:182665198-182665220 CAGAGCAGGGTTGAGGAAGAGGG - Intronic
918332030 1:183471044-183471066 CAGAGCAGGGAGGAACTTGGAGG + Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920537837 1:206751499-206751521 CAGTCCAGGGAAGAGGATGGAGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921186056 1:212670490-212670512 CAGCGCAGGGATGAGGTTGGAGG + Intergenic
921186214 1:212671791-212671813 CAGGGCAGGGATGAGGCTGGAGG - Intergenic
921669233 1:217908008-217908030 CAGTGCAGGTAGGCGGATGGAGG - Intergenic
921919258 1:220647890-220647912 CAGAGGAGGGCGGAGGTCGCGGG + Intronic
922212907 1:223499180-223499202 AAGAGCAGGGAGGAGGTGCCAGG - Intergenic
922515361 1:226203975-226203997 CAGAGCAGGGACTAGGGTGATGG + Intergenic
922866286 1:228863944-228863966 CAGCGCAGGGAGCAGGCTCCTGG - Intergenic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923010360 1:230083374-230083396 CGGAGCAGGGAGTGGGATGATGG + Intronic
923015716 1:230125297-230125319 CAGAGAAGGGAGGGGGCTGTGGG + Intronic
923044218 1:230343605-230343627 TCGTGCAGTGAGGAGGATGCTGG - Intronic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
924615306 1:245607369-245607391 TAGAGCAGGCAGGAGCAGGCTGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062976915 10:1690827-1690849 AAGAGTAGGGAGGAGGATCGGGG - Intronic
1063461734 10:6219180-6219202 CCGTGCCGGGAGGAGGCTGCTGG - Intronic
1063869281 10:10400711-10400733 CACAACTGGGAGGTGGATGCAGG + Intergenic
1064665320 10:17644516-17644538 CAGAGCTGGGAGGAGGTTGAGGG + Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1066111427 10:32200531-32200553 CAGAGAAGAGGGGAGGATGAGGG + Intergenic
1066617028 10:37305564-37305586 TAGGGCAGGGAGCAGCATGCAGG + Intronic
1067282240 10:44881216-44881238 CAGACCAGGGTGGAGGCTCCCGG + Intergenic
1068638816 10:59378767-59378789 CAGAGAAGGGCAGAGGATGAGGG - Intergenic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069778567 10:70940972-70940994 CAGGGCTGGGAGGAGGGAGCAGG - Intergenic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1070162405 10:73874208-73874230 CAGGGCGCGGAGGGGGATGCGGG + Intronic
1070308567 10:75255971-75255993 CATATCAGGGAGGATGAGGCAGG + Intergenic
1070742024 10:78909479-78909501 CAGAGTAGGGTGGAGGATAATGG - Intergenic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071432703 10:85618810-85618832 CAGAGCTGGGAGTAGAATCCAGG - Intronic
1071576202 10:86728530-86728552 CAGAGCAGTGAGTATCATGCAGG - Intronic
1072472914 10:95731211-95731233 CAGAGCAGGGTGGAGGAGAATGG - Intronic
1072612871 10:97030829-97030851 CTGAGAAGGGAAGAGGCTGCTGG + Intronic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1073076605 10:100828514-100828536 CGAGTCAGGGAGGAGGATGCAGG - Exonic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1073708822 10:106016433-106016455 CAGAGCAGTGGGGGGGATGTTGG + Intergenic
1073733215 10:106315759-106315781 CAGAGGAGCCAGGATGATGCAGG + Intergenic
1073788298 10:106914184-106914206 GAAGGAAGGGAGGAGGATGCTGG + Intronic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074595403 10:114860323-114860345 CGCAGCAGGGAGGAAGATGGTGG + Intronic
1074830180 10:117242077-117242099 GAAAGCAGGCAAGAGGATGCGGG - Intronic
1074887236 10:117703824-117703846 AAGAGCTGGGATGAGGATGGGGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075574690 10:123570053-123570075 CACTGCAGGTGGGAGGATGCAGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1076164099 10:128268263-128268285 CAGAGCAGGCGGGAAGAGGCAGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076284172 10:129277219-129277241 CAGTGCTGAGAAGAGGATGCAGG + Intergenic
1076332079 10:129677642-129677664 TAGAGCAGGGACGAGGAGGCAGG - Intronic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076582164 10:131518948-131518970 CTGGGGAGGAAGGAGGATGCTGG + Intergenic
1076736437 10:132461240-132461262 AGGAGGAGGGAGGAGGATGGAGG - Intergenic
1076793013 10:132786607-132786629 CACAGGAGGGCGGAGGACGCGGG + Intergenic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1076912603 10:133399243-133399265 CAGAGCTGGGAGTGGGAGGCGGG + Intronic
1076984255 11:223825-223847 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984276 11:223897-223919 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984318 11:224041-224063 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1077029729 11:459638-459660 CAGACGTGGGAGGAGGAGGCAGG - Intronic
1077047473 11:552801-552823 CAGAGCATGGCTGAGGAAGCAGG - Intronic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077161043 11:1113047-1113069 CACAGCAGGGAAGAGCAGGCAGG - Intergenic
1077540177 11:3142980-3143002 CAGAGCAGGGCAGAGGAGGCAGG + Intronic
1077540216 11:3143105-3143127 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540230 11:3143155-3143177 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540236 11:3143180-3143202 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077607088 11:3619673-3619695 TAGAGCAGGAAGGATGAGGCCGG + Intergenic
1077634927 11:3835920-3835942 CTGGGCTGGGAGGAGGAAGCTGG + Intronic
1078144625 11:8714408-8714430 CTGAGCAGGGAGGTGGGTGTGGG - Intronic
1078336123 11:10464650-10464672 CAGACCCCAGAGGAGGATGCTGG - Intronic
1078367733 11:10720587-10720609 CAGAACAGGGAGGGAGATGGAGG + Intergenic
1078848712 11:15144520-15144542 AGGAACAGGGAGGAGGCTGCTGG - Intronic
1078922350 11:15842385-15842407 CAAAGCAGGGAGGGGGAAGGAGG + Intergenic
1078930029 11:15905680-15905702 CAGAGGAGGGAGGTGGCTGGTGG - Intergenic
1079064425 11:17276926-17276948 CAGAGCAGAGAGGATGGTGGGGG + Intronic
1079267924 11:18953496-18953518 CATATCAAGGAGGAGCATGCAGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080947926 11:36995889-36995911 GAGAGGAGTGAGGAGGATGAGGG - Intergenic
1081547483 11:44081680-44081702 CAGAGCAGGGTCGAGCATGGAGG + Intronic
1081736972 11:45410998-45411020 AAGGGCAGGGAGGTGGAGGCGGG - Intergenic
1081737499 11:45414119-45414141 CTGAGGAGGTAGGAGGCTGCAGG + Intergenic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1083290359 11:61686543-61686565 CTGAGCCTGGAGGAGGATGGAGG + Intronic
1083446994 11:62714827-62714849 CACAGCAGGTAGGAGCAGGCAGG - Exonic
1083678278 11:64340071-64340093 CAGAGATGCTAGGAGGATGCAGG + Intergenic
1083904326 11:65660277-65660299 CAGAGTAGGAAGGAGCAGGCTGG - Intronic
1083925510 11:65803768-65803790 AAGTGCAGGAAGGAAGATGCTGG + Intergenic
1084139469 11:67215460-67215482 CAGCACACGGAGGAAGATGCAGG - Intronic
1084273797 11:68041931-68041953 CAGAGAAGGGAGGTATATGCAGG + Intronic
1084420622 11:69058769-69058791 CTTTGCAGGGAGGAGGCTGCGGG - Intronic
1084681793 11:70670629-70670651 CCGACCAGGAAGCAGGATGCTGG - Intronic
1085052838 11:73388659-73388681 CAGACCTGTGAGGAGGAGGCGGG + Intronic
1085276856 11:75306129-75306151 CAGAGCAGGGATGGGGAGTCAGG - Intronic
1085296228 11:75433251-75433273 GCGAGCAGGGAGGGGGATGCTGG + Intergenic
1085389057 11:76172925-76172947 CAGAGAAGGAAGGAGCCTGCTGG - Intergenic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086157341 11:83682178-83682200 CAAAGCAGGGAGGAGGCAGGAGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088521950 11:110711253-110711275 CAAAGCTGGGAGAGGGATGCAGG - Intronic
1089315102 11:117586172-117586194 CAGAGCTGGGACTAGAATGCAGG + Intronic
1089352154 11:117827958-117827980 CTGAGCAGGGAGGAGGAATGGGG + Intronic
1089539549 11:119181713-119181735 AAGAGCAGGGAGAAGGATAGGGG + Intronic
1089557713 11:119323770-119323792 CAGAGCAGGTGGGAGGATGGGGG + Intergenic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089689711 11:120179649-120179671 CACAGCCAGGAGTAGGATGCAGG - Intronic
1089691787 11:120191410-120191432 GAGACCAGGGAGGAGGAAACTGG + Intergenic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1091058831 11:132443231-132443253 GAGAGCAGTGAGGAGGATCTAGG + Intronic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1091237638 11:134032742-134032764 CGGAGCCTGGAGGAGGATGGAGG - Intergenic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1092147803 12:6226858-6226880 CAGAGCAGGAGGGAGGAGCCGGG + Intronic
1092204878 12:6608566-6608588 CAGAGCAGGGAGGGCCAGGCAGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092726737 12:11493963-11493985 CAGAGCAGGGAGGGAGTGGCAGG - Intronic
1094144502 12:27214397-27214419 CAGAGCAGGGCAGAGGAGGTAGG + Intergenic
1094353302 12:29550467-29550489 CAGAGGAGCGAGGAGGTGGCAGG + Intronic
1095307927 12:40660141-40660163 CAGAGGAGGGAATAGGATCCAGG - Intergenic
1096192793 12:49631285-49631307 CAGAGCAGGGTGGAGGGTTGGGG + Intronic
1096230471 12:49894069-49894091 CAGAGCTGGGATGTGAATGCGGG - Intronic
1096470701 12:51873806-51873828 CAGAGCAGGGCAGAGAATGGAGG - Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096559542 12:52425640-52425662 CAGAGCTAGGAGGAGGCTGGAGG + Intronic
1096596432 12:52698839-52698861 CAGAGGAGGAAGCAGGATTCTGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098331096 12:69354580-69354602 CAGAGGAGGGTGGAGGATAAGGG - Intergenic
1098366827 12:69712219-69712241 CAGAGCAGGGTGGAGAAGACTGG + Intergenic
1098384853 12:69907948-69907970 CAGAGCAGGGAGGGCCTTGCAGG - Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098394423 12:70003098-70003120 AGGAGGAGGGAGGAGGAGGCAGG + Intergenic
1099064935 12:77963997-77964019 AAGAGGAGGGAGGAGGAGGGAGG - Intronic
1099949763 12:89288590-89288612 CAGAGCATGAAGGAGGTTTCTGG + Intergenic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1101319581 12:103661777-103661799 CAGAGCAGAAAGGAGCATGCTGG + Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102756149 12:115342534-115342556 GAGAGCAGGGAGGAGGGAGAAGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103237440 12:119385193-119385215 CAGAGCAGGGAGGAGAAGGGTGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103444077 12:120982507-120982529 CAGAGCTAGGATTAGGATGCAGG - Intronic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103561457 12:121795142-121795164 CAGAGCTGGGAAGGGGAGGCCGG + Intronic
1103741150 12:123092500-123092522 CAGACCTGGGATGAGGATGAGGG - Intronic
1103742725 12:123102173-123102195 CAGAGCAGGAGGGAGAAGGCTGG + Intronic
1103749454 12:123149713-123149735 CAGAGCAGAGAGGAGTCTGGGGG + Intronic
1103986583 12:124771630-124771652 CAGAGCAGGGAGTAGCACGCAGG + Intergenic
1103997036 12:124837002-124837024 CAGACCAGCGAAGAGAATGCTGG + Intronic
1104018308 12:124975145-124975167 CAGAGCAGGGGGCCAGATGCAGG - Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104298248 12:127538755-127538777 CAAAGCGGGGAGGAGGCTTCCGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104607109 12:130198243-130198265 CAGTGCAGGGAGGAAGATGCTGG + Intergenic
1104748251 12:131223155-131223177 ATAGGCAGGGAGGAGGATGCAGG - Intergenic
1104753632 12:131255466-131255488 AAGAGCAGGGAAGAGGCTCCAGG - Intergenic
1104939357 12:132387644-132387666 CAGAGAGGGGAGGGAGATGCGGG + Intergenic
1104939371 12:132387696-132387718 CAGAGAGGGGAGGGAGATGCGGG + Intergenic
1104939413 12:132387856-132387878 CAGAGAGGGGAGGGAGATGCGGG + Intergenic
1104939420 12:132387881-132387903 CAGAGAGGGGAGGGAGATGCGGG + Intergenic
1104939477 12:132388145-132388167 CAGAGAGGGGAGGGAGATGCAGG + Intergenic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1105533635 13:21243518-21243540 CAGAGATGGGAGGAGGGTGAGGG + Intergenic
1106102409 13:26706554-26706576 CAGGGCGTGGAGGAGGATGTTGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106255625 13:28019820-28019842 CAGAGCAGTGGGGAGAAAGCAGG - Intronic
1107882283 13:44843245-44843267 CAGAGCAGGAAGGAGCCAGCGGG + Intergenic
1108225556 13:48285503-48285525 CACAGCAGGGAGGAAGAAGGTGG - Intergenic
1108350560 13:49586965-49586987 AAAATCAGGGAAGAGGATGCTGG - Intergenic
1110545133 13:76747458-76747480 CAGAGCTGGGAGGAAGATGATGG + Intergenic
1110766306 13:79283285-79283307 AAAAGCAGGGAGGGGGGTGCAGG + Intergenic
1112342536 13:98564529-98564551 AAGAGCAGAGAGGAGGAAGCTGG + Intronic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1112806406 13:103167795-103167817 CACAGCAGGGAGGAGAAGGGCGG + Intergenic
1113311390 13:109136702-109136724 AAGAACAGTGAGGAAGATGCTGG - Intronic
1113527549 13:110992373-110992395 CAGAGCAGGGATGGGGGAGCGGG - Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113839698 13:113351731-113351753 CCGAGCAGGAAGGATAATGCCGG + Intronic
1113861393 13:113490079-113490101 CAGCGCAGGAGGGAGGCTGCTGG - Intronic
1113879422 13:113615431-113615453 CACATCAGGGAGGAGAGTGCAGG - Intronic
1114426346 14:22626841-22626863 CAAAGCAGGGAGGCGGTTGAGGG - Intergenic
1114614106 14:24059316-24059338 CAGGGCATTGATGAGGATGCTGG - Exonic
1114680266 14:24478317-24478339 CAGAGAAGTGAGGAGGCTGGAGG + Intergenic
1114941993 14:27623979-27624001 TAGAGCAGGGAGGGGGACTCTGG + Intergenic
1115308650 14:31957486-31957508 ATTAGCAGGGAGGAGGCTGCTGG + Intergenic
1115491157 14:33959707-33959729 CAAAGCAGTGCGCAGGATGCTGG - Intronic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117528286 14:56633369-56633391 GAGAGGAGGGAAGAGGGTGCTGG + Intronic
1117659087 14:57985642-57985664 GAGAGCAGGCAGGAGCAAGCTGG - Intergenic
1118137345 14:63045010-63045032 CCAAGGGGGGAGGAGGATGCAGG - Intronic
1118153129 14:63211155-63211177 CAGAGCAGGGAGTGGGAAACAGG + Intronic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119411531 14:74434476-74434498 AAAAGCAGTGGGGAGGATGCAGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119567074 14:75637842-75637864 TAGTGCAGGGAGAAGAATGCAGG + Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119778845 14:77265117-77265139 CAGAGCATGGAGGAGCATGCAGG + Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119947437 14:78709648-78709670 CAGATCAGGTAGGAAGAGGCAGG + Exonic
1120810881 14:88802422-88802444 CAGAGCAGGGAGGAACTGGCTGG - Intergenic
1121018499 14:90563536-90563558 CTGATCAGGGTGGTGGATGCTGG + Intronic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1121226964 14:92328179-92328201 TAGGCCAGGGAGGAAGATGCTGG - Intronic
1121449021 14:93996192-93996214 CTCAGGAGGGAGGTGGATGCAGG - Intergenic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1121638330 14:95468640-95468662 AAGAGCAGGGAGGAAGGAGCAGG - Intronic
1121762549 14:96458191-96458213 GAGAGCATGGAGCAGAATGCAGG + Exonic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1121991545 14:98562527-98562549 CAGAGCAAGGAAGAGGCTGAAGG - Intergenic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122464049 14:101918454-101918476 CAGAGGAGCGAGGGGGATGAAGG - Intronic
1122602021 14:102926316-102926338 AAGGGCAAGGCGGAGGATGCTGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122861980 14:104586812-104586834 CAGCTCAGGGAGGAGGGTGTTGG + Intronic
1122870471 14:104635909-104635931 TAGAGCACGGGTGAGGATGCGGG - Intergenic
1124154939 15:27217574-27217596 CACAGCACGGAGCAGGATCCTGG - Intronic
1124551185 15:30682702-30682724 GAGAGCAGGGAAGATGTTGCTGG - Intronic
1124680062 15:31722962-31722984 GAGAGCAGGGAAGATGTTGCTGG + Intronic
1125281355 15:38045223-38045245 CAGAGCAGGGTGGAGAAGGATGG - Intergenic
1125352317 15:38780875-38780897 CAGAGCAGGGCTGAGAAGGCTGG - Intergenic
1125472910 15:40021829-40021851 CAGAGCAGGTGGGAGGGTGGTGG - Intronic
1125514317 15:40309228-40309250 CAGGGCAGGGTGGAGGGTGAGGG + Intergenic
1125832604 15:42727568-42727590 CAGAGCAGGGGGGTGGGAGCAGG + Intronic
1125883677 15:43213221-43213243 CCAAGCAGAGAGGAGGAGGCTGG - Intronic
1126321938 15:47434384-47434406 AAGCGGAGGGAGGAGGATCCTGG + Intronic
1127106490 15:55622121-55622143 CAGAGTGGGGAGGATGATGTAGG - Intronic
1127142339 15:55990775-55990797 GAGAGCAGTGTGGTGGATGCGGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1128535371 15:68486210-68486232 CAGAGCAGGGAGGAGAAAGGTGG + Intergenic
1128548478 15:68583011-68583033 CTTAGCAGGGAGGAGCATGTTGG - Intronic
1128559263 15:68653876-68653898 CAGAGCAGTGATGAAGATTCAGG - Intronic
1128784062 15:70381804-70381826 CACAGCAGGGAAGCTGATGCTGG - Intergenic
1128802743 15:70507275-70507297 CAGACCAAGGAGGATGGTGCTGG - Intergenic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1128937507 15:71759741-71759763 AAGAGAAGGGAGCAGGATTCAGG + Intronic
1129054956 15:72812676-72812698 CAGAGCATGGAAGAAGAAGCAGG - Intergenic
1129258058 15:74345402-74345424 CAGAGCAGGGAGGAGGTGAGAGG - Intronic
1129386804 15:75200927-75200949 CAGAGCAGGCCTGAGGCTGCAGG - Intronic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1130052596 15:80496289-80496311 GGGAGCAGGGAGAAGGGTGCTGG - Intronic
1130164186 15:81436219-81436241 AGGAGCAGGGAGCAGGATGAGGG - Intergenic
1130632498 15:85582794-85582816 CAGTGCAGGGGATAGGATGCAGG + Intronic
1131317510 15:91352924-91352946 AAGAGCAGGGAGGAGAGTGGAGG - Intergenic
1131458054 15:92598557-92598579 TTCAGCAGGGAGGATGATGCGGG - Intergenic
1131955385 15:97729782-97729804 TAGATGAGGGAGGAGGAAGCAGG - Intergenic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132291076 15:100704358-100704380 CAGAGCTGTGAGGAGGATTTGGG - Intergenic
1132354292 15:101159634-101159656 CTGGGCAGGGAAGGGGATGCTGG + Intergenic
1132482858 16:175251-175273 CAGGGCAGGGAGCAGGCTGAAGG + Intergenic
1132700111 16:1218691-1218713 CAGGACAGGGAGGAAGATGGGGG + Intronic
1132807496 16:1781934-1781956 CGGTGGCGGGAGGAGGATGCAGG - Intronic
1133061831 16:3179938-3179960 CAGCCCAGGGAGGTGGGTGCCGG - Intergenic
1133089965 16:3396461-3396483 CAGAGCAGGAAGCAGCTTGCTGG - Intronic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133147275 16:3798123-3798145 CAGCCCAGGCAGAAGGATGCAGG + Intronic
1133162702 16:3922509-3922531 CAGGGCAGGGAGGAAGCCGCTGG + Intergenic
1133170681 16:3980910-3980932 CAGAGCAGAGAGGGTGATGCAGG + Intronic
1133198808 16:4189878-4189900 CACAGCATGGAGGAGCAGGCAGG + Exonic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133831870 16:9330718-9330740 CAGTGCAGAGAGGGGAATGCAGG + Intergenic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134749874 16:16617461-16617483 CATAGCATGAAGGAGGATGGTGG + Intergenic
1134995602 16:18736154-18736176 CACAGCATGAAGGAGGATGGTGG - Intergenic
1135188945 16:20338736-20338758 CATAGCAGGGAGGCCGAGGCAGG - Intronic
1135435018 16:22420909-22420931 AAGAGCAGGAGGGAGGACGCGGG + Intronic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135542900 16:23345978-23346000 GAGAGAAGGGAGGGGGAAGCAGG + Intronic
1135622940 16:23971427-23971449 CAAAGAAGGCAGGAGAATGCTGG - Intronic
1135771895 16:25224206-25224228 CAGAGCTGGGATGTGGATGCAGG + Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136469945 16:30473475-30473497 TAGAGCTGGGAGGAGGGTGCTGG + Intronic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1137592303 16:49700937-49700959 CAGAGGAGGGAGGAGAAGGGAGG + Intronic
1137726087 16:50657675-50657697 GAGATAAGGGAGGAGGCTGCAGG - Intergenic
1137783573 16:51118400-51118422 AAGAGCTGGGAGCAGAATGCAGG - Intergenic
1138248026 16:55481144-55481166 CAGAGCAGGGAATGGGCTGCTGG + Intronic
1138422984 16:56912060-56912082 CTGGGGCGGGAGGAGGATGCTGG - Intronic
1138428347 16:56951370-56951392 GAGGGCAGGGTGGAGGATGCGGG + Intergenic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1138533039 16:57645485-57645507 CAGGGCAGGGAAGAGAGTGCTGG + Intronic
1139578435 16:67857266-67857288 CAGAGCAGAGACCAGAATGCAGG + Intronic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139802097 16:69530966-69530988 CAGAGCAGGGATCAGAATGTGGG + Intergenic
1139831663 16:69803659-69803681 CAGACCTGGGAGGCGGAGGCAGG + Intronic
1139851509 16:69953412-69953434 CGGAGCAGGGAGGTGCCTGCAGG - Intronic
1139880485 16:70176324-70176346 CGGAGCAGGGAGGTGCCTGCAGG - Intronic
1139973216 16:70789343-70789365 CAGAGCAGGAGGGAGAAGGCAGG - Intronic
1140372025 16:74419193-74419215 CGGAGCAGGGAGGTGCCTGCAGG + Intronic
1141128388 16:81417400-81417422 CAGGGCTGGGTGGAGGATGGTGG + Intergenic
1141173253 16:81704256-81704278 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173302 16:81704379-81704401 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173423 16:81704676-81704698 GGGGGCAGGGAGGAGGATGAAGG - Intronic
1141206889 16:81939580-81939602 CAGAGCAGGAAGGTGGATTTTGG - Intronic
1141442006 16:84035106-84035128 CAGAGGACGGATGAGGATACGGG - Intronic
1141623334 16:85248703-85248725 CCAAGCAGGGAGGGGGGTGCTGG + Intergenic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142062937 16:88042342-88042364 CAGCTCGGGGAGGAGGAAGCTGG - Intronic
1142189387 16:88710841-88710863 CCGCGCAGGGAGGTGGAGGCGGG + Intronic
1142293361 16:89202633-89202655 CGGAGCAGGGCGGGGGCTGCAGG - Intergenic
1142299549 16:89248363-89248385 CGGAGCAGGGCGGGGGCTGCAGG - Intergenic
1142772212 17:2106642-2106664 GAGAGAGGGAAGGAGGATGCTGG + Intronic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1142982447 17:3679946-3679968 GAGAGCAGGGTGGAGGATGCAGG - Intronic
1143099717 17:4498621-4498643 CGGAGCTGGGAGCAGGGTGCTGG - Intergenic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143377366 17:6474605-6474627 CTGCGGAGGGAGGAGGACGCAGG + Intronic
1143383306 17:6509652-6509674 CTGAGCAGGGAGGAGCATGCAGG - Intronic
1143483835 17:7242143-7242165 CAGCGCAGGGATCAGGCTGCTGG - Intronic
1143587104 17:7855781-7855803 CAGGGCAGGTCGGAAGATGCCGG - Exonic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1144196756 17:12902014-12902036 CAGAGAAGGGAAGAGGAAGGAGG - Intronic
1144339512 17:14300613-14300635 CAGAGTAGGGAGGCGGTTGGAGG - Intergenic
1144687556 17:17236419-17236441 CAGGGCAAGGAGGAGCTTGCTGG - Intronic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1144884918 17:18451334-18451356 GGGAGCAGGGAGGAGGGGGCTGG - Intergenic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145023230 17:19448270-19448292 CAAAGCAGGGAGGAGGTCCCAGG + Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145147305 17:20493043-20493065 GGGAGCAGGGAGGAGGGGGCTGG + Intergenic
1145302837 17:21653164-21653186 CGGAGCTGGGATTAGGATGCGGG + Intergenic
1145347466 17:22050027-22050049 CAGAGCTGGGATTAGGATGCGGG - Intergenic
1145763166 17:27439350-27439372 CAGAGAAGGGATGAGGAAGCAGG - Intergenic
1146178115 17:30679608-30679630 CAGAGGAGGGGGGAGGACGGGGG + Intergenic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1146654555 17:34627167-34627189 CAGATCCGGGATTAGGATGCTGG - Intronic
1146701101 17:34961123-34961145 CAGAGCAGGGATGAGAATGAGGG + Intronic
1146789407 17:35743023-35743045 CACAGCAGGGACTAGAATGCAGG - Exonic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147177989 17:38668720-38668742 GAAAGCAGGGAGGGGCATGCTGG + Intergenic
1147520923 17:41172621-41172643 CAGAGAAGGGAGGCTGAGGCGGG + Intergenic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147746744 17:42699350-42699372 CAGGGCAGGGGGGAGGCTGGGGG - Exonic
1147747289 17:42702599-42702621 CAGAGCAGGGAAGAGGAACCAGG + Intronic
1147767649 17:42847583-42847605 CAGAGCTGGGAGGAGTATGCAGG + Intronic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148559362 17:48597203-48597225 CAGAGGAGGGAGGAGGAATAAGG - Intronic
1148690595 17:49524777-49524799 CAATTCAGAGAGGAGGATGCAGG + Intergenic
1148746701 17:49922363-49922385 GGGAGCAGGGAGTAGGAAGCAGG - Intergenic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1148846678 17:50533783-50533805 CAGAGGAGGGAGGAAGCTGAGGG - Intronic
1148853093 17:50564246-50564268 CAGATCAGAGGGGAGCATGCTGG + Intronic
1149521390 17:57320916-57320938 CATGGCAGGGAGCAGGCTGCAGG - Intronic
1149677251 17:58477047-58477069 CAGCGCTGGGAGGAGGTGGCTGG - Intronic
1149991447 17:61385744-61385766 GAGAGCTGAGAGGTGGATGCAGG + Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151180093 17:72321029-72321051 CAGTGCAGGAAGCATGATGCTGG + Intergenic
1151238413 17:72738507-72738529 CAGATGTGGGAGGATGATGCTGG + Intronic
1151451045 17:74198489-74198511 CAGAGTAGGGACGAGGCTCCTGG + Intergenic
1151489996 17:74427191-74427213 CTGGGCAGGGAGGGGGATGAGGG + Intronic
1151499795 17:74481442-74481464 CAGAGCAGGACGAATGATGCTGG + Intronic
1151575478 17:74950832-74950854 CAGAGCTGGGTGAAGGATGAGGG + Exonic
1151684757 17:75639967-75639989 CAGCTCAGGGTGGAGGAAGCCGG - Exonic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1151970553 17:77455391-77455413 CAGAGCAGGGCGGGGGCAGCAGG - Intronic
1152187556 17:78867473-78867495 CATTGCAGGGAGGAAGATGCAGG - Intronic
1152295769 17:79466192-79466214 TAGAGGAGGGAGGAGGCCGCTGG - Intronic
1152528208 17:80901812-80901834 CAGAGCAGGGAGGGCGCTGGGGG - Intronic
1152561509 17:81081130-81081152 GAGAGCTGGGAGGTGGATCCAGG + Intronic
1152613946 17:81329472-81329494 CAGAGGAGGGAGGAGGGAGGAGG + Intronic
1152683855 17:81684141-81684163 CAGCGCCGGGCGGAGGCTGCGGG - Intronic
1152818864 17:82425404-82425426 TAGAGAAGGCTGGAGGATGCTGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153886900 18:9475443-9475465 CTGAGCGGAGAGGAGGATCCGGG + Intronic
1154000077 18:10475248-10475270 CAGAGCAGGGAGGAGAAAATGGG - Intronic
1154043407 18:10881451-10881473 CAGAGGTGAGAGTAGGATGCCGG + Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155045209 18:22097260-22097282 CAGAGTAGGGAGGAGGATACTGG + Intronic
1155046551 18:22108532-22108554 GGGAGCAGGGAGGAGTATGTAGG + Intergenic
1155066542 18:22273778-22273800 AGGAGGAGGGAGGAGGATGGAGG - Intergenic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156676678 18:39535352-39535374 AAGAACAGTGAGGAGGATGATGG - Intergenic
1157276983 18:46317999-46318021 AAAACCAAGGAGGAGGATGCAGG - Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157446852 18:47752825-47752847 CAGAGCTGGGAGGAAGAACCAGG + Intergenic
1157484831 18:48079586-48079608 CAAAGCAGAGAGGATGAAGCTGG + Intronic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157602369 18:48902039-48902061 CTGAGCTGGCAGGAGGACGCAGG + Intergenic
1157737130 18:50059688-50059710 CAGAGCGGGGAGGTGGCAGCTGG - Intronic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1157940270 18:51921255-51921277 AATACCAGGGAGGAGAATGCAGG + Intergenic
1160076953 18:75686638-75686660 CAGAGCAGAGAGGAGCCTGGCGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160570535 18:79814581-79814603 CAGAGCTGGGAGGGGGTGGCAGG + Intergenic
1160680947 19:411351-411373 CCGAGCCGGGAGGAGGGTCCTGG + Intergenic
1160845063 19:1162623-1162645 CAAAGCTGGGAGAAGGTTGCCGG - Intronic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161403963 19:4081670-4081692 AAGAGCAGGGAGGAGGGAGGAGG - Intergenic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162810608 19:13162706-13162728 CAGAGTGGGGAGGAGGCTTCGGG - Intergenic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163051765 19:14689862-14689884 CAGAGCATGGAGGGTGGTGCTGG - Intronic
1163349243 19:16765005-16765027 GAGAGAAGGGGGGAGGATGTGGG - Intronic
1163606556 19:18279084-18279106 CAAAGTAGGGAGTAGGATGTTGG + Intergenic
1163687058 19:18717683-18717705 CAGCTCAGAGAGGAGGGTGCAGG + Intronic
1163844650 19:19631504-19631526 CAGAGCTGGGAAGCGGCTGCTGG - Intronic
1164677391 19:30110805-30110827 CGGAGGACGGAGGAGGAAGCGGG - Intergenic
1165139436 19:33689970-33689992 CAGAGCAGGAAGGGTGATTCTGG + Intronic
1165248639 19:34513019-34513041 CAGAGAAGGAAGGAAGATGGAGG - Intergenic
1165256184 19:34578389-34578411 CAGAGAAGGAAGGAAGATGGAGG - Intergenic
1165256692 19:34580546-34580568 CAGGGCAGGGAGGAAGAGACAGG - Intergenic
1165265894 19:34663847-34663869 CAGGGCAGGGAGGAAGAGACAGG + Intronic
1165266379 19:34665936-34665958 CAGAGAAGGAAGGAAGATGGAGG + Intronic
1165274016 19:34733022-34733044 CAGAGAAGGAAGGAAGATGGAGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165327300 19:35121599-35121621 CAGAGCGGGGAGTAGGGAGCAGG - Intronic
1165472177 19:36010033-36010055 CAGAGCATCCAGGAGCATGCAGG + Intronic
1165613043 19:37173419-37173441 CAGAGGAGGGAGGAGAAGTCCGG + Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166082361 19:40452036-40452058 GAGACCAGGGAGTAGGCTGCTGG - Intronic
1166146939 19:40844557-40844579 CAGAGAGGGGAGGAGGGTGAGGG + Intronic
1166351636 19:42201627-42201649 CAGAGCAGAAAGGAGAATGCAGG + Intronic
1166710758 19:44935747-44935769 ATTAGCAGGGAGGAGGGTGCAGG + Intergenic
1166783626 19:45354885-45354907 CAGAGAAGGGAGGAGGACCTGGG - Intronic
1167204269 19:48089739-48089761 CAGAGCCGGGATGTGGATCCAGG + Intronic
1167267422 19:48490671-48490693 CAGAGCAGGGAGGACACAGCTGG - Intronic
1167282147 19:48575888-48575910 GAGAGTAGGGAGGTGGGTGCTGG - Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167485877 19:49762762-49762784 CAGAGAAGGGAGGAGAAAGTAGG - Intronic
1167526298 19:49985979-49986001 CAGAGCAGTTGTGAGGATGCAGG + Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1168276880 19:55283882-55283904 GAGAGGAGGTGGGAGGATGCAGG - Intronic
925033612 2:670764-670786 CAGAGCTGGCAGGAGGCCGCAGG + Intronic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
925451453 2:3973044-3973066 CACAGCAGGCAGGAGGGTGGTGG + Intergenic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
925862600 2:8194475-8194497 GAGAGGAGGGAGGAGGATGGTGG - Intergenic
925983543 2:9196451-9196473 CAGGGCAGGGAAGGGGATGGAGG - Intergenic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926185601 2:10688351-10688373 GAGAGCAGGGTGGATGAGGCTGG - Intronic
926329827 2:11815213-11815235 CAGGGCAGAGAAGAGGCTGCTGG - Exonic
926555590 2:14354240-14354262 CAGGGCAGGGAAGGGGAGGCAGG + Intergenic
926837782 2:17043613-17043635 CAGAGCAGGGATGAGGACCCAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927683428 2:25154947-25154969 AAGGGCAGGAAGCAGGATGCAGG + Exonic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927871654 2:26627947-26627969 GATACCAGGGAGGAGGAGGCTGG - Intronic
928253200 2:29699912-29699934 CAGAGCAGTGAGGATGGTTCTGG + Intronic
928998832 2:37325254-37325276 GGCAGCAGGGAGGAGCATGCGGG - Intergenic
929066340 2:37978864-37978886 CAGAGGATGGAGGTTGATGCAGG + Intronic
929193654 2:39163489-39163511 CAGAGCAGAGAGTAGAATACTGG + Intergenic
929562510 2:42964603-42964625 CAGAGCTGGGTGGAGGCGGCTGG + Intergenic
929593682 2:43162549-43162571 CAGAGCTGGGAGTAGGACCCAGG - Intergenic
929658727 2:43760792-43760814 CAGGGCTGGGAGGAGGAGGGAGG - Intronic
929759027 2:44790881-44790903 CAGGTCAGGGAGGCGGATTCTGG - Intergenic
929888044 2:45895854-45895876 TAGAGAAGGGTGGAGGATGCAGG + Intronic
929965350 2:46530393-46530415 TGGAGAAGGGAGGAGGATGATGG - Intronic
930154510 2:48092467-48092489 CAGAGCCTGGATGAGGATGTGGG - Intergenic
931000477 2:57775225-57775247 CAGAGAAGGGTAGAGGAAGCTGG - Intergenic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931553190 2:63469933-63469955 CACTGCATGGAGGAGCATGCAGG - Intronic
932219854 2:69991103-69991125 CAGAGCAGTGGTGACGATGCAGG - Intergenic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932432994 2:71686547-71686569 CCGAGCTGGGCGGAGGAGGCAGG - Exonic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
933897128 2:86821824-86821846 AAGAGAAGGGTGGAGGAAGCAGG - Intronic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934211606 2:89984532-89984554 CAAAGCAGGGGTGAGGATGGGGG + Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934724471 2:96606546-96606568 CAGAGTAGGAAGGAGGGTGTAGG + Intronic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935129028 2:100247595-100247617 CAGAGGCAGGACGAGGATGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935383584 2:102478586-102478608 GAAAGCAGGAAGGAGGATGGGGG + Intronic
935404791 2:102697667-102697689 TAGAGCAGGGAAGTGGGTGCGGG + Intronic
936024119 2:109018277-109018299 CAAAGCAGGATGGAGGAAGCAGG + Intergenic
936076488 2:109404835-109404857 CGGATGAGGAAGGAGGATGCTGG - Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936514684 2:113174226-113174248 CAGAGCAGGAAGGGGGAAGGAGG - Intronic
936760726 2:115778019-115778041 CAGAGCAGGAAGGAGCAAGCAGG - Intronic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
937206299 2:120239094-120239116 CTGAGCAGGGCCGTGGATGCTGG - Intergenic
937339394 2:121081478-121081500 TAGAAGAGGGATGAGGATGCTGG + Intergenic
937784049 2:125874341-125874363 CAGAGCTGGGAGGAGGCAGACGG + Intergenic
937854527 2:126662865-126662887 CAGGGCAGTGGGGAGGAAGCTGG - Intronic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939229237 2:139405645-139405667 CAGAGAAGGGAGGAGCTTCCTGG + Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
940133710 2:150412624-150412646 CAGACCAAGGAGGAGCAAGCTGG + Intergenic
940485406 2:154290244-154290266 CAAAGCAGGGAAGAAGGTGCAGG + Intronic
941043503 2:160648588-160648610 CAGAGCTGGCAGGAGCAGGCAGG + Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941729401 2:168899319-168899341 CAGAGGAGTGGTGAGGATGCTGG + Intronic
942104028 2:172614431-172614453 CAGAGCAGGGCAGAGGATGACGG + Intergenic
942428388 2:175883638-175883660 GGGAGCTGGGAGCAGGATGCTGG + Intergenic
942651758 2:178176262-178176284 CAAAGCAGGGAAGATCATGCAGG - Intergenic
944089299 2:195887814-195887836 AAGAGGAGGGAGGGGGATGGTGG - Intronic
944416576 2:199485170-199485192 CAGAGCAGGGAGGTTGCTGAAGG + Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946030488 2:216699889-216699911 CTGTCCAGGGAAGAGGATGCGGG - Intergenic
946046868 2:216828616-216828638 TGGAGCAGGGAGGAGGAGTCTGG + Intergenic
946186015 2:217980776-217980798 CAGAGCAGGGAGCATGCTGGAGG - Intronic
946187845 2:217991181-217991203 CAGAGGAGGGAGGAGGGCCCAGG + Intronic
946217833 2:218199485-218199507 CAGAACATGGAGGAGCATGTTGG - Intergenic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
946884579 2:224210401-224210423 CAAAGCATGGAAGAGCATGCAGG + Intergenic
947227075 2:227850927-227850949 TAAAGCAGGGAAGAGGATGATGG - Intergenic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947463023 2:230319503-230319525 CTGGGTGGGGAGGAGGATGCAGG + Intergenic
947533679 2:230928010-230928032 ACGGGGAGGGAGGAGGATGCTGG + Intronic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948497263 2:238359381-238359403 CAGAGCAGAGGGGTGGCTGCTGG - Intronic
948577726 2:238965240-238965262 CAGAGGAGGGAGGAGTAAGGAGG - Intergenic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948844042 2:240674738-240674760 CACAGCAGGGAAGAGGAGCCAGG + Intergenic
948849768 2:240699897-240699919 CACAGCAGGGAAGAGGAGCCTGG - Intergenic
948851627 2:240711162-240711184 CAGAGCAGGCAGGAAGCTGGGGG + Intergenic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168897024 20:1330845-1330867 TAGAAGAGGGAGGAGGAAGCAGG + Intronic
1168930472 20:1619336-1619358 CAGGGGAGGGAGGAGCATGGGGG + Intronic
1169263758 20:4155424-4155446 CAGAGCAGAGAGAAGCATCCAGG - Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169776645 20:9262452-9262474 AAGAGCATGGAGGATGAGGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170705949 20:18745087-18745109 AAGAGCAGGAAGGGAGATGCAGG - Intronic
1170808699 20:19656372-19656394 CAGAGCAGAGAGGTTCATGCTGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1170921389 20:20683078-20683100 CAGAGCAGCGGGGTGGATGGAGG - Intronic
1170981116 20:21213799-21213821 CTGAGCAAGGAGGAGGACACAGG - Intronic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172781339 20:37438519-37438541 CAGAGCAGGGAGGAGGAGCGGGG + Intergenic
1173130977 20:40393253-40393275 CAGAGCTGGGAGGATGTTTCAGG - Intergenic
1173167748 20:40697875-40697897 CAGAGCAGGGAGGGAGAGACTGG + Intergenic
1173717430 20:45221241-45221263 CTGAGCAGGGGTGAGGAAGCTGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173837429 20:46135041-46135063 GAAAGCAGGAAGGAGGGTGCGGG - Intergenic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1173867821 20:46323788-46323810 CAGAGCAGAGATGAGGAGTCTGG + Intergenic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1174349280 20:49955516-49955538 GAGACCAGGGAGGCGGCTGCAGG + Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174482598 20:50841960-50841982 CAGCGTGGGGAGGAGCATGCAGG + Intronic
1175156649 20:56976093-56976115 CAGATGAGGGAGGAGCATGGAGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1175773089 20:61635864-61635886 CAGAGCAGGGGGCAGGACACAGG + Intronic
1175781920 20:61688310-61688332 GAGAGGAGGGAGGAGGAAGGTGG - Intronic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1175978560 20:62725766-62725788 AAGAGGAGGGAGGAGGACGGAGG + Intronic
1176045633 20:63091251-63091273 CCGAGAGGGGAGGAGGCTGCAGG - Intergenic
1177994467 21:28079382-28079404 CATAGCTCGGAGGAGGATGAAGG - Intergenic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178615890 21:34132477-34132499 CAGAGCAGTTAGGAGGGTGAAGG + Intronic
1179167339 21:38945108-38945130 CAGAGCTGGGCGGAGGAGGATGG - Intergenic
1179219025 21:39390135-39390157 CAGAGGTGGGAGTAGGATGTTGG + Intronic
1179343201 21:40531847-40531869 CAGAGCATTGAGTGGGATGCTGG - Intronic
1179410139 21:41156235-41156257 CGGAGCAGAGAGGAGGATGTAGG - Intergenic
1179536377 21:42055400-42055422 AATAGCAGGGAGGAGGAGGAAGG + Intergenic
1179613369 21:42566353-42566375 CAAAGCTGGGAGGAGGTGGCTGG - Intronic
1179682124 21:43030018-43030040 GACAGCACAGAGGAGGATGCGGG + Exonic
1179878167 21:44281919-44281941 CAGAGCAGGGAAGGGGCTGGAGG - Intergenic
1180954015 22:19733402-19733424 CAGTGCGGGGAGGAGGGAGCTGG - Intergenic
1181043391 22:20203473-20203495 CAGTGCTGGGAGGTGGAGGCTGG + Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181462651 22:23094649-23094671 CAGAGCAAGGTGGAGGCTTCAGG - Intronic
1181860461 22:25813883-25813905 TGGGGCAGGGAGGAGGATGCAGG - Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183105262 22:35610848-35610870 CTGGGCAGGTGGGAGGATGCGGG - Intronic
1183161544 22:36117011-36117033 CAGAGCTGGGATGAGAATGAGGG - Intergenic
1183425238 22:37735538-37735560 CTGAGCCTGGAGGGGGATGCAGG - Intronic
1183455973 22:37923567-37923589 CAGAGCACGGCAGAGGCTGCAGG - Intronic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184103213 22:42352477-42352499 CAGAGCAGAGAAGAGTGTGCGGG - Intergenic
1184104517 22:42359719-42359741 CAGTGCAGGGAGGACCATGATGG - Intergenic
1184640798 22:45868972-45868994 CACTGCAGGAAGGAGGCTGCAGG - Intergenic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184738811 22:46415105-46415127 GAGCTCAGGGAGGAGGATGGGGG + Intronic
1184764302 22:46563710-46563732 CAGCCCAGGTAGGAGGATGCTGG - Intergenic
1185281752 22:49972641-49972663 GGGACCAGGGAGGAGGAGGCGGG - Intergenic
1185340077 22:50287232-50287254 CAGGGCAGGGAGGGGGCTGACGG + Exonic
1185421280 22:50735636-50735658 GAGAGCAGGGAGGAGTTTGAGGG + Intergenic
949107002 3:211368-211390 GAGAGCACAGAGTAGGATGCAGG + Intronic
949391862 3:3571440-3571462 CTGATCAGGGTGGAGGTTGCTGG - Intergenic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
950090036 3:10288819-10288841 CAGACCAGTGAGGAGGAAGAGGG + Intronic
950113857 3:10438061-10438083 GAGAGCAGGGAGGGGGGTGGCGG + Intronic
950203310 3:11059800-11059822 CAGCTCAGGGAGGAAGGTGCAGG + Intergenic
950521529 3:13500612-13500634 CTGAGCAGGGAGGATGCTGGGGG + Intronic
950546040 3:13638636-13638658 CAGAGGAGGGAGGAGGGAGGAGG - Intergenic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
951079032 3:18429295-18429317 AAGAGCAGGGAGGAAGAAGCTGG + Intronic
951337072 3:21436274-21436296 CATAGCAGGGAGGAAAATACTGG - Intronic
952181136 3:30917813-30917835 CAGAGCAGGGTGGAGAAAGATGG - Intergenic
952189401 3:31006702-31006724 CAGAGGAGTGGGGTGGATGCTGG - Intergenic
952211210 3:31231138-31231160 CAGAGCAGGGAGGACAAGGAGGG + Intergenic
952283750 3:31948023-31948045 CACACCAGAGTGGAGGATGCAGG + Intronic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
952970832 3:38649409-38649431 CGGGGCAGGGAGGAGCACGCAGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953374037 3:42413604-42413626 CAGGGCAGGGTGGAGTGTGCTGG + Intergenic
953717698 3:45330056-45330078 GAGATGAGAGAGGAGGATGCAGG - Intergenic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954600112 3:51860931-51860953 CAAAGCAGGGAGGACCATGACGG - Intergenic
954628035 3:52033378-52033400 GAGAGCAGGGAGAGGGGTGCAGG - Intergenic
954695530 3:52422908-52422930 CAGAGCAAGGAGGGGGCTGTAGG + Intronic
954923257 3:54210147-54210169 TAGAGCAGTAAGGAGGATGTGGG + Intronic
954993032 3:54857311-54857333 CAGAGCAGAGTGGAGGAAACGGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955793200 3:62609271-62609293 GAAAGGAGAGAGGAGGATGCAGG - Intronic
955805154 3:62726022-62726044 CTGAGAAGGGAGGAGGCTGACGG + Intronic
956184671 3:66551143-66551165 CAGAGCAGTAAGGAGGTTGCAGG - Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957980777 3:87507918-87507940 CACATCTGGGAGGTGGATGCTGG + Intergenic
960667723 3:120126928-120126950 CAGAGCAGGAATTTGGATGCAGG - Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961022613 3:123521660-123521682 CACCACAGGGAGGAGGGTGCAGG + Intronic
961381739 3:126500042-126500064 GAGAGCAGGTAGGAGGAAGGAGG - Exonic
961491752 3:127261271-127261293 AAGAGCAGGGAGGAGCAGGAGGG - Intergenic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961648105 3:128403374-128403396 CAGTGCAGGGAGGAAGATGGGGG + Intronic
962207940 3:133450478-133450500 TAGGGCAGAGTGGAGGATGCTGG - Intronic
962361782 3:134749026-134749048 AAGGGCAGGGAGGAGGACTCAGG + Intronic
962501937 3:136003732-136003754 CAGAGCTGGGAAGAAGATGAAGG - Intronic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
963249898 3:143093686-143093708 CTGAGCGGAGAGGAGGAGGCTGG + Intergenic
963517462 3:146326421-146326443 CAGAGGAGGAATGAGGATGAAGG + Intergenic
964421388 3:156507369-156507391 CAGAGCATGTATTAGGATGCAGG - Intronic
965706392 3:171512149-171512171 CAGAGCACGAAGGTGGATGTGGG - Intergenic
965966485 3:174496934-174496956 CAGAGAAGGTATCAGGATGCTGG - Intronic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966891982 3:184413779-184413801 GAAAGCAGGGAAGAGGAGGCCGG - Intronic
967666377 3:192177588-192177610 CAGAGCAGTAAGGAGGAAACAGG - Intronic
968161606 3:196431949-196431971 CAGAGAAGGGAAGATGATGAAGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968452162 4:680870-680892 CAGAGCCGGAAGGAGGTTACAGG - Intronic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
968541892 4:1172182-1172204 CGGAGCAGGGAGGGGGTCGCGGG - Intronic
968973995 4:3811639-3811661 CAGTGCAGGGAGGGGGGTGCTGG + Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969135036 4:5022480-5022502 AAGAGCTGGTGGGAGGATGCAGG - Intergenic
969135815 4:5027880-5027902 CAGAGCTGGGAGATGGATGGAGG + Intergenic
969217783 4:5735856-5735878 CAGAGCAGGAAGGACCCTGCTGG - Intronic
969264779 4:6057338-6057360 CAGAGAAGGGAGGAGGGAGTTGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969517678 4:7656671-7656693 CTGAGCAAGGAGGCAGATGCAGG - Intronic
969539483 4:7777989-7778011 CAGGGAAGGGAAGAGGGTGCTGG + Intronic
969632126 4:8345032-8345054 CACAGCAGAGAGAAGGATCCAGG + Intergenic
970345578 4:15149428-15149450 CAGAGCAGGCAGTCTGATGCGGG - Intergenic
970454503 4:16209213-16209235 CAGACCTGGGACGAGGATCCAGG - Intronic
970852216 4:20615914-20615936 CAGGGAAGGGGGGAGGGTGCTGG - Intronic
970870401 4:20810442-20810464 CAGGGCAGGGGGGAGGAAGGGGG + Intronic
972345425 4:38188725-38188747 CTGAGCAAGGATCAGGATGCAGG - Intergenic
972572932 4:40327219-40327241 CAGAACAGGGCAGAGGATGGGGG + Intergenic
973604010 4:52569165-52569187 TAGAGCAAGGAGGAGCATGTGGG + Intergenic
973680212 4:53309526-53309548 CGGTGCAGGGAGGAGGAGTCAGG + Intronic
975697824 4:77031100-77031122 CAGTGCAGGGAAGATGATGAAGG + Intronic
976555663 4:86448711-86448733 CAGAGCAGGGAGGTGGCTTCAGG + Intronic
976596716 4:86901803-86901825 CATAGCAGGTGGGAGTATGCTGG - Intronic
977569003 4:98610828-98610850 AAGAGTAGCGGGGAGGATGCCGG - Intronic
978518720 4:109596579-109596601 CAAAGCAGGGAGGACCATGACGG + Intronic
979624226 4:122827422-122827444 AAGATCCGGGAGGAGGGTGCAGG - Intronic
980993755 4:139761429-139761451 TGGAGCAGGGAGGAGGAAGAAGG - Intronic
981005580 4:139871673-139871695 CAGCTCAGGGAGGAGGACCCAGG - Intronic
981988934 4:150892475-150892497 CACAGCAAGGAAGAGGATGTAGG + Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
983054312 4:163083771-163083793 CAGAGCTGGGAGGAGGGTGCAGG + Intergenic
983904724 4:173170157-173170179 CCCAGCGGGGAGGAGGAAGCAGG - Intronic
985626886 5:993644-993666 AACAGCAGGGAGGAGAAGGCTGG + Intergenic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
985923051 5:2994477-2994499 CAGAGCAGGGCGGAGGGTGGAGG - Intergenic
986286070 5:6360075-6360097 GAGAGCTGGAAGGAGGAGGCAGG + Intergenic
986289958 5:6391833-6391855 CAGTGCAGTGAGGAGAATTCTGG - Intergenic
986445357 5:7816368-7816390 GAGAGCAGGGAGGAGGCTTGGGG - Intronic
986516633 5:8571409-8571431 CATATCAAGGAGGAGGCTGCTGG - Intergenic
986662804 5:10074339-10074361 GTGAGCAGGGAGGAGGATTTGGG - Intergenic
987035822 5:14017342-14017364 CAAAGCAGAGAGTGGGATGCTGG - Intergenic
987312026 5:16690447-16690469 CTGCCCAGGGAGGAGGCTGCTGG + Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988579435 5:32455978-32456000 CAGAGAAGGGTGGAGAATGGTGG + Intergenic
988684525 5:33514333-33514355 CAGAGACGAGAGGAGGATTCAGG + Intergenic
988792313 5:34620015-34620037 GAGGGCAGGGAAGAGGCTGCTGG + Intergenic
988797055 5:34660987-34661009 TAAAGCAGGGATGAGGTTGCAGG - Intronic
988910832 5:35840654-35840676 CAAAGCAGGGAGGGGGTTCCAGG + Intergenic
989230055 5:39074710-39074732 GCGAGCGGGGAGGAGGAGGCCGG + Intergenic
989347132 5:40441611-40441633 CAGAGCTGCGAGGAGAACGCAGG - Intergenic
990990519 5:61679049-61679071 CACAGAAGGAAGGAGGAAGCAGG + Intronic
992553533 5:77881655-77881677 CAGCGCAGAGAGGATGATGCGGG + Intergenic
992557241 5:77915868-77915890 CAGAGGTTGGGGGAGGATGCAGG + Intergenic
993168244 5:84384095-84384117 CCGAGCGGGGAGAAGGGTGCGGG - Intronic
996442769 5:123511083-123511105 CAAAGCAGGGAGGAAAATGAAGG + Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996630797 5:125629809-125629831 CAGCCCAGGGAAGAGGAGGCTGG + Intergenic
996748662 5:126867851-126867873 CAGGGCAGGCAAGAGCATGCTGG + Exonic
997300224 5:132798239-132798261 CAGACCAGGGATGAGGATTGGGG - Intronic
997719862 5:136069621-136069643 CAGAGCAGGGAAGAAGCTACTGG + Intergenic
997801239 5:136864762-136864784 CAGTGGAGGGAGGAGGCTGATGG + Intergenic
997878091 5:137566886-137566908 CAGAGCAGGGACGGGCAGGCAGG - Intronic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998299875 5:141007680-141007702 CAGAGGAGGGAGGTGGAAGTAGG - Intronic
998599880 5:143574797-143574819 GAGACCAGGGAGGAGGCTGTTGG - Intergenic
998621062 5:143794572-143794594 CAGGTCAGAGAGGACGATGCTGG + Intergenic
998753221 5:145347634-145347656 CAGAGCAGTGAGGTGGTTGAGGG + Intergenic
998797239 5:145833651-145833673 CAGAGGAGTGAGGAGGACACTGG - Intronic
998971109 5:147593452-147593474 GAGAGCAGGGAGGAAGAAGAGGG - Intronic
999150335 5:149422446-149422468 AGGAGAAGGGAGGAGGAGGCCGG + Intergenic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999425630 5:151485614-151485636 CAGAGCTGGGACCAGGATCCAGG - Intronic
1000714267 5:164621597-164621619 CCCAGCAGTGAGGAGGATACTGG - Intergenic
1001223473 5:169924070-169924092 CAGGGCAGGGAGGAAGAGGGTGG - Intronic
1001276187 5:170353519-170353541 CAGAGCAGGGAGGGAGGAGCTGG - Intronic
1001516158 5:172356614-172356636 CAGAGCAGGGAGGCTCATGCAGG + Intronic
1001633164 5:173191753-173191775 CGTGGCAGGGAGGAGGAAGCAGG - Intergenic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001699134 5:173694164-173694186 CAGTGCATGGAGGAGGACTCAGG - Intergenic
1001759474 5:174195315-174195337 CAAAGCACTGAGGAGGATCCTGG - Intronic
1001795973 5:174502647-174502669 CAGAGCAGGGAGGTGGACAGAGG + Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002181152 5:177431726-177431748 CAATGCAGGGAGGTGGATGGAGG + Intronic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002568447 5:180127287-180127309 CTGGGCAGGGAGGAGGGTGGAGG - Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002643384 5:180641106-180641128 CCGGGCAGGGAGGAGCCTGCTGG - Intronic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1003144056 6:3494760-3494782 CAGAGCTGAGAGGAGAATGCGGG + Intergenic
1003377451 6:5593025-5593047 CAGAGATGGGAGGAGGGTGAGGG - Intronic
1003880104 6:10472353-10472375 CAGAGCATGAAAGAGGCTGCAGG + Intergenic
1004157544 6:13183614-13183636 CTGATCAGGGAGGAGGAAGGAGG + Intronic
1004546555 6:16603715-16603737 CAGAACAGGCAGGAGGAAGTAGG + Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083585 6:21981319-21981341 CAGCTCAGGAAGGAGGAGGCAGG - Intergenic
1005083603 6:21981431-21981453 CAGAGCAGAAAAGAGGAGGCAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005426673 6:25710193-25710215 CAGAACAGCCAGGAGGATTCGGG - Intergenic
1005587773 6:27293836-27293858 CGGAGAAGGGGCGAGGATGCGGG + Intronic
1006065932 6:31462774-31462796 CAGTTCAGGGAGGGGGATTCTGG + Intergenic
1006068027 6:31476609-31476631 CAGTGCAGGGGGCAGGATGGAGG - Intergenic
1006100037 6:31680912-31680934 ACGAGCAGGGACGAGGAAGCGGG + Intronic
1006734184 6:36260829-36260851 TGGGGCAGGGAGGAGGGTGCGGG + Intronic
1006802133 6:36766048-36766070 CAGAGCTGGGAGGAGGGAGGTGG + Intronic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007527255 6:42507433-42507455 CAGAGCTGGGAGTAGAATTCAGG - Intergenic
1007815870 6:44525291-44525313 GAGACCAGGGAGGAGACTGCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010277585 6:73987859-73987881 TACAGCAGGGAGTAGGATGTGGG + Intergenic
1010330844 6:74622751-74622773 CAGAGAAGGCAGGAAGATGTGGG + Intergenic
1010744913 6:79549683-79549705 AAAATCAGGGAGGAGGAAGCTGG + Intergenic
1011198067 6:84802963-84802985 CAGAGCAGGGTGGAGAAGACTGG - Intergenic
1011733759 6:90293123-90293145 CTGAGCAGGGAAGAGGAAGGGGG + Intronic
1011811237 6:91134509-91134531 AAGAGGAGGGAGGAGCCTGCAGG - Intergenic
1012960030 6:105612584-105612606 CCCAGCTGGGAGGAGGATCCAGG + Intergenic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1013627423 6:111951619-111951641 CAGTGCAGGTAGGAAGTTGCCGG + Intergenic
1015116443 6:129654762-129654784 CTGGGCAGAGAGGAGGATCCAGG - Intronic
1015379579 6:132551360-132551382 CAGAGCGGGTAGGAGGAGACTGG - Intergenic
1015768569 6:136745475-136745497 TGTGGCAGGGAGGAGGATGCTGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016618355 6:146079056-146079078 GGGAGCAGGGAGGAGGAGCCTGG - Intronic
1017547767 6:155469973-155469995 CAGAGCAGGCAAGAGGAGACGGG + Intergenic
1017753407 6:157509906-157509928 GAGAGCAGAGTGGAGGCTGCAGG - Intronic
1017927406 6:158922283-158922305 CCGAGCCAGGAGGAGGAAGCCGG - Intergenic
1018027889 6:159819838-159819860 AACAGCAAGGAGGGGGATGCAGG + Intronic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018211454 6:161486552-161486574 CAGAGCAAGGATCAGAATGCAGG + Intronic
1018372039 6:163177396-163177418 CAGAGCTGGGAGGAGAAACCTGG + Intronic
1018416016 6:163602874-163602896 CGCTGCAGGGAGGAGGATTCTGG - Intergenic
1018855378 6:167670643-167670665 AAGAGAAGGGATGAGGATCCTGG - Intergenic
1018890023 6:167976663-167976685 CTGTGCGGGGAGGAGGAGGCAGG + Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1018964375 6:168473162-168473184 CAGAGCAGGGAGTGGGATCAGGG + Intronic
1019049006 6:169169069-169169091 CAGAGCACGGTGGAGGGTGGGGG + Intergenic
1019126196 6:169841553-169841575 CAAAGCAGGGAGGGGGCTTCCGG + Intergenic
1019140172 6:169937863-169937885 CAGGGCAGGCAGGAGGCTTCAGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019475580 7:1242636-1242658 GGGAGCGGGGAGGAGGAGGCGGG - Intergenic
1019508589 7:1405714-1405736 CAGAGCGGGGCAGGGGATGCAGG + Intergenic
1019517584 7:1446611-1446633 AGGAGCGGGGAGGAGGAGGCCGG + Intronic
1019517857 7:1447594-1447616 CAGAGGAGGAATGAGGGTGCAGG - Exonic
1019731972 7:2633513-2633535 CACAGCAGGGAGGAGGGAGGCGG + Intronic
1019795247 7:3043806-3043828 CAGGGCCGGGAGGGGGCTGCGGG + Exonic
1020282858 7:6659145-6659167 CAGGGCAGGGAGGAGGACAAGGG - Intergenic
1021527294 7:21603027-21603049 CAGGGCATGGAGGAGGATAATGG - Intronic
1021820785 7:24495353-24495375 CACAGGAGGATGGAGGATGCTGG - Intergenic
1022381733 7:29866760-29866782 CAGAGCAGGAAGGAGTGGGCAGG - Intronic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022482081 7:30751023-30751045 CAGAGCAGGCAGGAAACTGCAGG - Intronic
1022498114 7:30865847-30865869 CAGTCCAGGGAAGACGATGCAGG - Intronic
1022570737 7:31451138-31451160 CAGAGCAGGAATAAGGGTGCTGG - Intergenic
1022787722 7:33655202-33655224 CAGAGCAGGAATGGGGATTCAGG - Intergenic
1023171561 7:37394604-37394626 CAGAGCAGAGAGGCTGATGAGGG + Intronic
1023365357 7:39458189-39458211 CTGAGCAGGGAGCAGGTTGGAGG + Intronic
1023532091 7:41168498-41168520 CAGACAAGGGAGGGGGATGGTGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023929826 7:44698454-44698476 CAGAGCACAGAGGAAGGTGCAGG + Intronic
1024059216 7:45685753-45685775 CAGAGCAGGCAAGAGGCTCCAGG - Intronic
1024122421 7:46257986-46258008 CAAAGCAGAGAGGAGGAACCAGG - Intergenic
1024226525 7:47329877-47329899 GGCAGCAGGGAGGAGGAGGCAGG + Intronic
1024359544 7:48454497-48454519 CAGAGCAGGGAAGCGGGAGCAGG + Intronic
1024945781 7:54806267-54806289 CAGAGCTGGGAGGGGGAGCCAGG + Intergenic
1026461792 7:70620995-70621017 CAGAGCGGGGAGGACCATGAGGG + Intronic
1026879579 7:73900243-73900265 CAGACCAGGGTGGAGAATCCGGG + Intergenic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1028604251 7:92638294-92638316 GATACCAGGGAGGAGGCTGCAGG + Intronic
1028696216 7:93716271-93716293 CTGACAAGGGAGGAGGAAGCTGG - Intronic
1028752309 7:94394758-94394780 CACAGCTGGGAGGAGCCTGCGGG - Exonic
1028773589 7:94655743-94655765 CAGAGCAGGGAGGGGCCCGCGGG + Intronic
1029194285 7:98793844-98793866 CAGAGGAGCGAGGTGCATGCAGG - Intergenic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029415895 7:100443056-100443078 CACAGCAAGGAGGAGAATGTTGG + Intergenic
1029459962 7:100688725-100688747 GAGAGCAGGGGGGAGGAGGGAGG + Exonic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029545215 7:101206911-101206933 GAGAGGAGGGAAGAGGCTGCAGG + Intronic
1030078849 7:105760007-105760029 TAGAGCAGGCAGGAGAATGAGGG - Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030173186 7:106625443-106625465 CAGAGCAGGTAGGAGCATTAGGG + Intergenic
1030311828 7:108076596-108076618 CAGGGCAGGGATGTGGAAGCAGG + Intronic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1033304241 7:140212784-140212806 TGGAGCAGGGAGGAGGCTTCAGG - Intergenic
1033590298 7:142803023-142803045 CAGTGCAGGACAGAGGATGCGGG + Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034716313 7:153245805-153245827 CAGAGCAGGGTGGAGAGTGGTGG - Intergenic
1034753203 7:153590364-153590386 CAGTGCAGGGAAGAGCCTGCAGG - Intergenic
1034825624 7:154259881-154259903 CAGAGCAGGCACGTGGCTGCTGG + Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035680435 8:1483660-1483682 CAGAGCAGGGAGGCAGGTGCAGG + Intergenic
1035765406 8:2100983-2101005 GACTTCAGGGAGGAGGATGCTGG + Exonic
1036748236 8:11425364-11425386 CCGAGCTGGGATGAGGAAGCCGG + Intronic
1036752298 8:11451042-11451064 CAGAAGAGGGAGGAAGCTGCTGG - Intronic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038207338 8:25479240-25479262 CACAGCAGGGAGGAGGGAGAGGG - Intronic
1038524035 8:28257977-28257999 CAGAGCAGAGAAGAGGAAACTGG + Intergenic
1038539892 8:28383721-28383743 CAGAGAAGTGGGGAGGCTGCTGG - Intronic
1038613680 8:29074345-29074367 CAAAGCAGGGAGCAGGATGGTGG + Intronic
1038731569 8:30132565-30132587 GTGAGCAGGGTGGTGGATGCAGG - Exonic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1039547667 8:38421453-38421475 CAGCGGAGGGGGGAGGCTGCTGG + Intronic
1039561072 8:38513077-38513099 CAGCGCAGGGTGGAGGCTGAGGG - Intronic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1040587614 8:48757963-48757985 CACAGCAGGAACGAGGAAGCCGG - Intergenic
1040663584 8:49604216-49604238 GAGAGTAGGGAGGGGGAAGCAGG - Intergenic
1040905630 8:52467318-52467340 CAGAGCAGGGAGGGAGCTGCAGG - Intergenic
1041283809 8:56239177-56239199 GAGAACAGGGAGGAGGATTATGG + Intergenic
1041426622 8:57728034-57728056 AAGAGCAAGGGTGAGGATGCTGG + Intergenic
1041783722 8:61607963-61607985 AGGAGCAGGAAGGAGGATGGGGG + Intronic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1043316652 8:78931151-78931173 CAGAGCAGGGAGTGGGATACAGG - Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044531228 8:93309969-93309991 CAGAGAAGGGAGGAAAGTGCAGG - Intergenic
1044745277 8:95365032-95365054 TTGAGCAGGGAGGAGGAGGCAGG + Intergenic
1045863272 8:106837018-106837040 CACAGCTGGGAGGAGGTTTCAGG + Intergenic
1046213232 8:111107302-111107324 CAGAGCAGGGAATAGGATGATGG - Intergenic
1047336337 8:123940223-123940245 CAGAGCATGGGGGAGGGTGGTGG + Intronic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047507244 8:125489507-125489529 CTCAGCAGGGAGGAGGATGGTGG - Intergenic
1048987212 8:139741042-139741064 AAGAGGAGGGTGGAGGATGTGGG + Intronic
1049187512 8:141265372-141265394 AAGAGAAGGGAGGAGTGTGCAGG + Intronic
1049199423 8:141332798-141332820 CAGAGCAGGGAAGGGTGTGCCGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049337895 8:142096220-142096242 CAGAGCAGTGAGGAGGAGCCAGG - Intergenic
1049363729 8:142226512-142226534 CAGAGCTGGGAGGGGGACCCTGG + Intronic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049429104 8:142550965-142550987 CAGGGCAGGGAAGAGGAGGGAGG + Intergenic
1049456205 8:142690987-142691009 CAAAGCAGGGAGGGGGTTTCCGG + Intergenic
1049513014 8:143039293-143039315 CCGTGCCGGGAGGAGGCTGCAGG - Exonic
1049564666 8:143331882-143331904 CAGGGCGGGGTGGAGGAGGCGGG + Intronic
1049632539 8:143666422-143666444 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632558 8:143666520-143666542 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632580 8:143666618-143666640 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632612 8:143666764-143666786 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049672578 8:143876522-143876544 AAGGGAAGGGAGGAGGAAGCAGG - Intronic
1050343239 9:4662179-4662201 GAGAGCAGAGGGGAGGATGTTGG - Intronic
1050396457 9:5203191-5203213 CAGAGCTGAGAGGACCATGCAGG - Intergenic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1050432388 9:5574954-5574976 CAAAGCAGGGAGGACAAGGCTGG - Intergenic
1050952847 9:11618781-11618803 CAGAGCAGAGCAGAGGGTGCTGG - Intergenic
1052353901 9:27484750-27484772 CAGGGCAGGGTAGAGGAGGCCGG - Intronic
1052776775 9:32740497-32740519 CAGACCTGGAAGGAGGAAGCAGG - Intergenic
1052973574 9:34396387-34396409 CAGATGAGGAAGGAGGATGTAGG - Intronic
1055462797 9:76535044-76535066 CAAAGCAGGGAGGGGGCTTCCGG - Intergenic
1056134733 9:83621103-83621125 CAGAGCAGGGAAGAGAAGGGTGG - Intergenic
1056827025 9:89883598-89883620 CAGGGCAGGGAGGTGGAGGGAGG - Intergenic
1057191811 9:93092611-93092633 CAGAGCTGGGAAGAGCATTCTGG + Intergenic
1057694099 9:97311348-97311370 CCTAGCAGGGAGGAAGCTGCTGG - Intronic
1057845372 9:98518598-98518620 CAGAGCAGGGCCGAGAAAGCAGG - Intronic
1057951123 9:99369771-99369793 CAGAGCAGTTTGGATGATGCTGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058433035 9:104935942-104935964 AAGAGGATGGAGGAGGAAGCAGG - Intergenic
1058706165 9:107639578-107639600 CAGGGGAGGGAGGAGGGTTCAGG - Intergenic
1059283575 9:113154374-113154396 CAGAGCTGGGAGGGAGATCCAGG + Intronic
1059393838 9:114017983-114018005 CAGAGCAGTGAGGGGCAAGCAGG - Intronic
1059439009 9:114292323-114292345 CAGAGCAAGGAGGTGGCTTCTGG - Intronic
1060756818 9:126219750-126219772 GAGAGCAGGGAGGGGGTTGCGGG - Intergenic
1060804160 9:126564320-126564342 CAGAGCAGGGAGCAGCAACCAGG + Intergenic
1060976324 9:127767218-127767240 CAGAGCGGAGCTGAGGATGCTGG + Intronic
1060980314 9:127788122-127788144 CAGAGCTGGGAGGAGGACCCAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061093018 9:128437236-128437258 CCGGCCAGGGAGGAGGGTGCTGG - Exonic
1061138464 9:128750415-128750437 TGGGGCAGGGAGGAGGATGGAGG + Intronic
1061238904 9:129357948-129357970 CAGGGCTGGAAGGAGGATTCCGG + Intergenic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1061376294 9:130226633-130226655 CATAGCTGGGAGGAGGAGGCTGG + Intronic
1061434025 9:130549324-130549346 CAGAGCATGAAGGATGGTGCAGG - Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062376629 9:136264653-136264675 CAGGGCAGGGATGGGGATCCCGG + Intergenic
1062394534 9:136347443-136347465 GTGAGCAGGGAGGAGGATGAGGG + Intronic
1062426932 9:136510445-136510467 AAGTGCAGGGAGGAGCAAGCCGG + Intronic
1062585523 9:137247753-137247775 CAGGGAAGGGAGCTGGATGCCGG - Exonic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1185761338 X:2691527-2691549 CCGGGCAGGGAGGAGGCTCCGGG - Intronic
1185827034 X:3261346-3261368 CAGACCAGGAAGGAGGAAGGAGG + Intergenic
1185877195 X:3711474-3711496 CGGGGCAGAGAGCAGGATGCGGG - Intronic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1186735875 X:12463380-12463402 CAGACTAGGGAGGAGAGTGCTGG - Intronic
1186871932 X:13782025-13782047 CGGGGCAGGGCTGAGGATGCTGG - Intronic
1187478274 X:19630990-19631012 CTTGGCAGGGTGGAGGATGCAGG - Intronic
1187688416 X:21839678-21839700 CGGTGCAGGGAGGAGGACGCCGG + Exonic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187877537 X:23816572-23816594 CACAGCAGTGAGGAGGAACCAGG + Intergenic
1188019773 X:25144451-25144473 CAGAGAAGGGCGAAGGATTCGGG + Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189322142 X:40093403-40093425 AAGAGGAGGGAGGAGGAGACTGG + Intronic
1189774203 X:44455530-44455552 GGGAGCGGGGAGGAGGATGTAGG + Intergenic
1189948448 X:46203968-46203990 GGGAGCGGGGAGGAGGATGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190572982 X:51803390-51803412 CAGACCAGAGAAGAGGATACGGG - Intronic
1190988656 X:55522926-55522948 CAGCCAAGGGAGGAGGGTGCAGG + Intergenic
1191105410 X:56769175-56769197 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1191106403 X:56774577-56774599 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1191107396 X:56779979-56780001 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1192184339 X:68936504-68936526 CAGAGAAGGGAGGAGAGAGCTGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192569382 X:72190230-72190252 AGTAGCAGGGAGGTGGATGCAGG - Intronic
1192591210 X:72360970-72360992 GTGAGCAGGCAGGAGGATGGGGG + Intronic
1194951228 X:100128829-100128851 ATGGGCAGGGAGGAGGATGTAGG + Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195923107 X:110002394-110002416 CGGAGGAGGGAGGAGGAGGGAGG + Intergenic
1198226386 X:134649517-134649539 TTGAGCAGGGAGGGGAATGCTGG - Intronic
1199300476 X:146207626-146207648 CAGAGCAGGCAGGAGAATTTAGG - Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200788090 Y:7276032-7276054 CGGGGCAGAGAGCAGGATGCGGG + Intergenic