ID: 1181361100

View in Genome Browser
Species Human (GRCh38)
Location 22:22336745-22336767
Sequence GACCCCCAGCCCCCCCGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181361100_1181361108 20 Left 1181361100 22:22336745-22336767 CCTGTCCGGGGGGGCTGGGGGTC No data
Right 1181361108 22:22336788-22336810 GATGAATACCTCATGCATACCGG No data
1181361100_1181361109 21 Left 1181361100 22:22336745-22336767 CCTGTCCGGGGGGGCTGGGGGTC No data
Right 1181361109 22:22336789-22336811 ATGAATACCTCATGCATACCGGG No data
1181361100_1181361107 -2 Left 1181361100 22:22336745-22336767 CCTGTCCGGGGGGGCTGGGGGTC No data
Right 1181361107 22:22336766-22336788 TCAAGGGGAGGGAGAGCATTAGG 0: 49
1: 881
2: 2119
3: 4200
4: 8117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181361100 Original CRISPR GACCCCCAGCCCCCCCGGAC AGG (reversed) Intergenic
No off target data available for this crispr