ID: 1181364237

View in Genome Browser
Species Human (GRCh38)
Location 22:22362768-22362790
Sequence AGCACTCCCCTCTCTAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181364237_1181364242 -6 Left 1181364237 22:22362768-22362790 CCCTGGTTAGAGAGGGGAGTGCT No data
Right 1181364242 22:22362785-22362807 AGTGCTTGTGGCCTGGAGGTAGG No data
1181364237_1181364245 27 Left 1181364237 22:22362768-22362790 CCCTGGTTAGAGAGGGGAGTGCT No data
Right 1181364245 22:22362818-22362840 TTATCAAATAAAAACACTGGAGG No data
1181364237_1181364244 24 Left 1181364237 22:22362768-22362790 CCCTGGTTAGAGAGGGGAGTGCT No data
Right 1181364244 22:22362815-22362837 AATTTATCAAATAAAAACACTGG No data
1181364237_1181364241 -10 Left 1181364237 22:22362768-22362790 CCCTGGTTAGAGAGGGGAGTGCT No data
Right 1181364241 22:22362781-22362803 GGGGAGTGCTTGTGGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181364237 Original CRISPR AGCACTCCCCTCTCTAACCA GGG (reversed) Intergenic
No off target data available for this crispr