ID: 1181364310

View in Genome Browser
Species Human (GRCh38)
Location 22:22363370-22363392
Sequence CTTTTGATGCTGAAGGTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181364302_1181364310 11 Left 1181364302 22:22363336-22363358 CCCTTTGTCCAGTGAGACAGCAA No data
Right 1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG No data
1181364303_1181364310 10 Left 1181364303 22:22363337-22363359 CCTTTGTCCAGTGAGACAGCAAA No data
Right 1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG No data
1181364304_1181364310 3 Left 1181364304 22:22363344-22363366 CCAGTGAGACAGCAAACTCCAGG No data
Right 1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181364310 Original CRISPR CTTTTGATGCTGAAGGTGCG TGG Intergenic
No off target data available for this crispr