ID: 1181365191

View in Genome Browser
Species Human (GRCh38)
Location 22:22371099-22371121
Sequence GGCTTCAGACAGCCCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181365184_1181365191 27 Left 1181365184 22:22371049-22371071 CCCAAGCATCTCTGGGCTCCAGG No data
Right 1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG No data
1181365186_1181365191 26 Left 1181365186 22:22371050-22371072 CCAAGCATCTCTGGGCTCCAGGC No data
Right 1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG No data
1181365188_1181365191 9 Left 1181365188 22:22371067-22371089 CCAGGCTGAGGACAACGCTGATC No data
Right 1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181365191 Original CRISPR GGCTTCAGACAGCCCCCTGG AGG Intergenic
No off target data available for this crispr