ID: 1181367439

View in Genome Browser
Species Human (GRCh38)
Location 22:22388973-22388995
Sequence AGCTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181367435_1181367439 16 Left 1181367435 22:22388934-22388956 CCCAGTAATAGGCCAAGAGCTGT 0: 16
1: 194
2: 203
3: 147
4: 222
Right 1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG No data
1181367437_1181367439 4 Left 1181367437 22:22388946-22388968 CCAAGAGCTGTCTCTCAAAAAGA No data
Right 1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG No data
1181367434_1181367439 22 Left 1181367434 22:22388928-22388950 CCAAAGCCCAGTAATAGGCCAAG 0: 17
1: 191
2: 171
3: 92
4: 154
Right 1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG No data
1181367433_1181367439 25 Left 1181367433 22:22388925-22388947 CCACCAAAGCCCAGTAATAGGCC 0: 13
1: 161
2: 162
3: 88
4: 160
Right 1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG No data
1181367436_1181367439 15 Left 1181367436 22:22388935-22388957 CCAGTAATAGGCCAAGAGCTGTC 0: 17
1: 183
2: 194
3: 123
4: 177
Right 1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181367439 Original CRISPR AGCTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr