ID: 1181373753 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:22439973-22439995 |
Sequence | CTTTTGATGCTGAAGGTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181373744_1181373753 | 7 | Left | 1181373744 | 22:22439943-22439965 | CCTTCTGTCCAGTGAGAAAACTC | No data | ||
Right | 1181373753 | 22:22439973-22439995 | CTTTTGATGCTGAAGGTGGGTGG | No data | ||||
1181373747_1181373753 | -1 | Left | 1181373747 | 22:22439951-22439973 | CCAGTGAGAAAACTCCAGGGTCC | No data | ||
Right | 1181373753 | 22:22439973-22439995 | CTTTTGATGCTGAAGGTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181373753 | Original CRISPR | CTTTTGATGCTGAAGGTGGG TGG | Intergenic | ||
No off target data available for this crispr |