ID: 1181373753

View in Genome Browser
Species Human (GRCh38)
Location 22:22439973-22439995
Sequence CTTTTGATGCTGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181373744_1181373753 7 Left 1181373744 22:22439943-22439965 CCTTCTGTCCAGTGAGAAAACTC No data
Right 1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG No data
1181373747_1181373753 -1 Left 1181373747 22:22439951-22439973 CCAGTGAGAAAACTCCAGGGTCC No data
Right 1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181373753 Original CRISPR CTTTTGATGCTGAAGGTGGG TGG Intergenic
No off target data available for this crispr