ID: 1181377844

View in Genome Browser
Species Human (GRCh38)
Location 22:22474708-22474730
Sequence CACCTTGCTGTGGTTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181377844_1181377853 25 Left 1181377844 22:22474708-22474730 CCCCAGGAAACCACAGCAAGGTG No data
Right 1181377853 22:22474756-22474778 GTTCAGGTTGTTCATATTTTAGG No data
1181377844_1181377851 9 Left 1181377844 22:22474708-22474730 CCCCAGGAAACCACAGCAAGGTG No data
Right 1181377851 22:22474740-22474762 CTCTCTGAAGCCTGACGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181377844 Original CRISPR CACCTTGCTGTGGTTTCCTG GGG (reversed) Intergenic
No off target data available for this crispr