ID: 1181380015

View in Genome Browser
Species Human (GRCh38)
Location 22:22494687-22494709
Sequence ATGCATAGAAATAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 8, 3: 52, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181380015_1181380020 29 Left 1181380015 22:22494687-22494709 CCTTCCAGATTATTTCTATGCAT 0: 1
1: 1
2: 8
3: 52
4: 374
Right 1181380020 22:22494739-22494761 GTTTTTTGTTTTTTTTGAGATGG 0: 194
1: 1537
2: 100506
3: 77653
4: 93211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181380015 Original CRISPR ATGCATAGAAATAATCTGGA AGG (reversed) Intronic
901135659 1:6992392-6992414 ATGGAAAGAAATAATCAGAAAGG - Intronic
901743096 1:11355307-11355329 ATAAATAAAAATAATGTGGAGGG + Intergenic
903444598 1:23413961-23413983 ATGCATAGGAATAGTCTAGCAGG + Intronic
905132642 1:35772530-35772552 ATGCATCAGAATAATCTGAAAGG + Intergenic
905638234 1:39570307-39570329 ATGCATAGAAAAGGTCTGGAAGG + Intronic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905943662 1:41884268-41884290 ATGCATAGAAAATTACTGGAGGG - Intronic
906252011 1:44318024-44318046 ATGCACATACATAATTTGGAGGG - Intronic
908163030 1:61430417-61430439 ATGCACAGAAACACTCTGGATGG - Intronic
908255280 1:62298282-62298304 GTGCATAAAAATTACCTGGAGGG - Intronic
909097568 1:71307256-71307278 AAGCATAGAAATAGTGTAGAAGG + Intergenic
909653462 1:78002089-78002111 ATACATAGAAATAGTCTATATGG - Intronic
909944241 1:81645541-81645563 ATGCATGGAAAAATTCTGGAAGG - Intronic
910376486 1:86577340-86577362 ATGCAAAGGAATCATCTCGAGGG + Intronic
911956557 1:104243088-104243110 ATGGATGGAAATAATATAGAAGG + Intergenic
913044189 1:115059484-115059506 ATGCATCCAAATCATCTGGATGG - Intronic
914437656 1:147673941-147673963 ATCCAGAGTAATACTCTGGAGGG - Intergenic
915581765 1:156816999-156817021 GGGCAGAGAAAGAATCTGGAGGG - Intronic
916690724 1:167187534-167187556 ATGCCTAGATAAAATATGGAAGG - Intergenic
918711825 1:187740669-187740691 ATACTTAGAAATAATTAGGAAGG + Intergenic
919178417 1:194049780-194049802 ATGTGTAGAAATAACCAGGAAGG - Intergenic
919474202 1:198014311-198014333 ATTCATAAAAACAATATGGATGG + Intergenic
919751189 1:201039367-201039389 ATGCAGAAAAATAATCCAGATGG + Intergenic
919994615 1:202737253-202737275 ATGTATAAGAATCATCTGGAAGG + Intronic
921056020 1:211543016-211543038 TTCCATAGAAAAAATCTGGAAGG + Intergenic
921065621 1:211620497-211620519 ATGCAGAGAAATACCCAGGAGGG + Intergenic
922884809 1:229010055-229010077 ATCCATAGAAATAAACTGGTTGG - Intergenic
922924879 1:229340565-229340587 ACCCACAGGAATAATCTGGAAGG + Intronic
922998728 1:229987840-229987862 ATGCAGAGGATTAGTCTGGAAGG - Intergenic
923140286 1:231156165-231156187 AACCAGAGAAAGAATCTGGATGG - Intergenic
923249381 1:232166085-232166107 ATGCAAAGAAGGATTCTGGATGG - Intergenic
923743245 1:236675226-236675248 ATGCATAGAAAAATTCTGAAAGG + Intergenic
924832578 1:247613920-247613942 AAGCATAGGAAGATTCTGGAAGG + Intergenic
1062908678 10:1198155-1198177 ATGCATAGTAATGTTCTTGAAGG - Intronic
1063570327 10:7209686-7209708 GTGCATAAAATAAATCTGGAAGG + Intronic
1063791999 10:9461074-9461096 ATGCAGAAAAATAATCTCGTAGG - Intergenic
1064463910 10:15560774-15560796 ATAAATAGAAATAATCTGGAAGG + Intronic
1064956685 10:20918947-20918969 ATGCATAGGAAAATTCTGGAAGG + Intronic
1064980276 10:21159729-21159751 ATGAATAGAAAGAATCTTGAAGG - Intronic
1065778823 10:29147498-29147520 ATGCATGCAGTTAATCTGGAAGG + Intergenic
1065909552 10:30289932-30289954 ATGCATAGAATTAATATTCATGG + Intergenic
1066049853 10:31622950-31622972 ATGCCTAGAAAACATCTGGAAGG + Intergenic
1068115858 10:52736668-52736690 AAGAATAGACATAATCTGAAGGG + Intergenic
1068787928 10:60997414-60997436 GGGCATAAAAATCATCTGGAAGG - Intronic
1069123881 10:64605285-64605307 ATGCAAAGCAATAATTTGGATGG + Intergenic
1069178870 10:65330914-65330936 TTGCTTCAAAATAATCTGGAAGG - Intergenic
1070239501 10:74664346-74664368 ATGCATAGAAAAATTCTAGAAGG + Intronic
1070804388 10:79262347-79262369 ATGCATTAGAATAATCTGGAAGG - Intronic
1070922763 10:80198594-80198616 ATGTATAAGAACAATCTGGAAGG - Intronic
1070995826 10:80780065-80780087 CTGCAGAGAAATTAGCTGGAAGG + Intergenic
1071466895 10:85949320-85949342 ATGCATAGAAAGGGTCTGGAAGG - Intronic
1072197161 10:93126028-93126050 ATGCCAAGAAGCAATCTGGAGGG + Intergenic
1073374161 10:103018432-103018454 ATTCAGAGGAATGATCTGGAGGG + Intronic
1073590714 10:104754928-104754950 AAGCACAGAAATAATCCAGATGG + Intronic
1073686938 10:105765200-105765222 ATGCATCAAAATCACCTGGAAGG + Intergenic
1074272704 10:111970908-111970930 AAGAATAGTGATAATCTGGAGGG - Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076676769 10:132151179-132151201 ATGCATAGATAAATTATGGAGGG - Intronic
1077977910 11:7268363-7268385 TGGCATAGAAAAAATATGGAAGG + Intronic
1079030906 11:16986015-16986037 ATGCATAGGAATTACCTGGATGG + Intronic
1079115340 11:17637156-17637178 AGCCATAGAGAGAATCTGGAAGG - Intronic
1079170552 11:18090862-18090884 ATAAATAGACATAATCTGGGAGG + Intronic
1079483063 11:20903681-20903703 TTGCATACAAATATCCTGGAAGG + Intronic
1079494864 11:21030843-21030865 ATGCATAGTAAAACCCTGGAAGG - Intronic
1079544828 11:21620625-21620647 GTGGATAGAAATAACCTGGGTGG + Intergenic
1079648988 11:22902720-22902742 ATGTCTTTAAATAATCTGGAAGG - Intergenic
1080028993 11:27641274-27641296 AGAGATAGAAATAATGTGGATGG + Intergenic
1080580664 11:33640627-33640649 ATGCATAGAAAACATCTGGAAGG + Intronic
1081975329 11:47230554-47230576 AAGCATAGAACTCAACTGGAGGG + Intronic
1083319489 11:61836970-61836992 ATGTATAGAAAAAAGCTGGAAGG + Intronic
1083407325 11:62467014-62467036 ATGTATTGAAATAAGCTGCAAGG - Intronic
1084750938 11:71204251-71204273 CTCCATGGAAATGATCTGGAAGG + Intronic
1086384176 11:86290009-86290031 ATGCATTGGGATCATCTGGAGGG + Intergenic
1086583792 11:88429202-88429224 CTGCATAAAAATCACCTGGAAGG - Intergenic
1087359356 11:97137852-97137874 TTGCAGAGAAATAATCTGCTTGG - Intergenic
1087586186 11:100124920-100124942 ATGCATAAAATTAATCTGGATGG + Intronic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1089963788 11:122638551-122638573 TTTCATAGAAATGATCTGTAAGG - Intergenic
1090167655 11:124568186-124568208 ATGCATAGGAAAAGTCTAGAAGG + Intergenic
1090489489 11:127145822-127145844 ATGCATGAGAATTATCTGGAGGG + Intergenic
1090823671 11:130367748-130367770 TTGCATAAACAAAATCTGGAAGG + Intergenic
1092990610 12:13894509-13894531 ATGCATAGAAAAATGCTGGAAGG + Intronic
1094055628 12:26266791-26266813 AAAAATAGAAACAATCTGGAGGG - Intronic
1095588975 12:43882201-43882223 TGGCATAGAAATATTATGGAAGG + Intronic
1095798138 12:46243250-46243272 GTGCATAGAAAAACCCTGGAAGG - Exonic
1095868939 12:47004125-47004147 GTGCATAGAAAAATACTGGAAGG + Intergenic
1096928815 12:55181064-55181086 ATACATAGAAACCAGCTGGAGGG - Intergenic
1097073555 12:56375149-56375171 ATTCATAGAAACAAAGTGGAAGG + Intergenic
1097098428 12:56568937-56568959 ATGCAAAGTAATAATCTGGGGGG - Intronic
1098199320 12:68038043-68038065 CTGCAAAGAAATCATCTGGAAGG - Intergenic
1098583117 12:72125292-72125314 ATACATATAAACAACCTGGAAGG - Intronic
1098848119 12:75562775-75562797 AAGACTAGAAATAACCTGGATGG - Intergenic
1098941546 12:76542465-76542487 ATGCATCACAATCATCTGGAGGG + Intronic
1099308218 12:80984823-80984845 ATGGATTGGAATAATATGGAAGG + Intronic
1099414283 12:82368501-82368523 ATGAATAGAAGTAATCTGCCTGG + Intronic
1100533911 12:95487664-95487686 GAGCATAGAAAAAATATGGAAGG - Intronic
1101597914 12:106183536-106183558 ATAACTAGAAAGAATCTGGAAGG + Intergenic
1101797387 12:107987934-107987956 ATGCATAGAAAATCTCTGAAAGG - Intergenic
1102032013 12:109745178-109745200 ATGCACATAAAACATCTGGAAGG - Intronic
1102714482 12:114958201-114958223 AAGCATAAAAATTCTCTGGAAGG - Intergenic
1104029518 12:125054300-125054322 ATACATAGAACTATTTTGGAAGG - Intergenic
1105005757 12:132719623-132719645 ATGCACAGAAATAACCGGGGCGG + Intronic
1105223204 13:18353291-18353313 ATGCATAAAATACATCTGGAAGG - Intergenic
1105791759 13:23807654-23807676 ATGCATAAAGATAATCAGGGAGG + Intronic
1106104152 13:26719210-26719232 ATGCTCAGAAATATTCGGGATGG - Intergenic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107279987 13:38722550-38722572 ATGCATCAAAATAACCTGGAGGG + Intronic
1107425733 13:40291037-40291059 ATGCACAGAAAGGATGTGGAAGG + Intergenic
1107637683 13:42409124-42409146 ATACTTAGAAATATTCTGTATGG + Intergenic
1107771644 13:43793502-43793524 ATGCAAAGAAAATGTCTGGAAGG - Intergenic
1107843395 13:44483930-44483952 ATTCATAAAAATAATCTAGAAGG - Intronic
1108457619 13:50632416-50632438 CTGCATAGGAATAGTCTTGAAGG + Intronic
1110227427 13:73134200-73134222 ATACATAGAAAAAAGTTGGATGG + Intergenic
1110619115 13:77575708-77575730 AAGCTTAGAAATAAGCTAGAAGG - Intronic
1112274199 13:98001176-98001198 ATTCATAGAAATAAAAAGGAAGG - Intronic
1112276751 13:98028361-98028383 ATGGCTACAAATAATCTGGCAGG - Intergenic
1112283380 13:98082365-98082387 ATGCATAGAACATTTCTGGAAGG + Intergenic
1112317227 13:98374019-98374041 ATGCATAGAAAAATTCAGAAAGG - Intronic
1112952201 13:105013242-105013264 ATGCATAGAATAAACCTAGACGG + Intergenic
1113446274 13:110370155-110370177 ATGCAATGCAATAATCTGGTTGG - Intronic
1113748553 13:112763105-112763127 AGGCATAGAAATTATCACGAAGG - Intronic
1114594137 14:23897370-23897392 ATATATAGAAAAAGTCTGGAAGG + Intergenic
1115608079 14:35025530-35025552 ATGCATAGATAAGATCTGGATGG - Intronic
1118426516 14:65669866-65669888 ATGCATGAGAATCATCTGGAAGG + Intronic
1118509799 14:66459556-66459578 AAGCATAGAAAATGTCTGGAAGG + Intergenic
1118731942 14:68674368-68674390 ACTCATAGAAAAATTCTGGAAGG - Intronic
1118813969 14:69295941-69295963 ATGCATAAAGAAATTCTGGAAGG - Intronic
1119213847 14:72853079-72853101 AGGCATAGAAAATATCTGGAAGG + Intronic
1119346385 14:73928225-73928247 ATGAATAGACATCATCTTGATGG + Intronic
1120168396 14:81224424-81224446 ATGTATAGAACTAATTTGTATGG - Intergenic
1120192357 14:81450659-81450681 ATGTATAGAAAAGATTTGGAAGG - Intergenic
1120405231 14:84085951-84085973 AGGCAATGAAATAATCTGCATGG - Intergenic
1120782952 14:88502350-88502372 ATGCATAGACAGAGTCTTGAAGG - Intronic
1120882197 14:89422241-89422263 ATGCATAGGAATTACCTGAAGGG + Intronic
1121372897 14:93376665-93376687 AAGCAGAGAAATCATCTGGTTGG + Intronic
1126548149 15:49895356-49895378 GTGCATAGGAATCACCTGGAGGG - Intronic
1126588937 15:50319976-50319998 ATGCATAGAAAAGATCTGGAAGG - Intronic
1126620065 15:50629560-50629582 ATGCTTAGAGAAAATATGGAAGG - Intronic
1127109632 15:55653758-55653780 AAACATAGAAATTATCTGGCCGG - Intronic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1127790866 15:62397703-62397725 ATGCATGGAAATCACCTGCAGGG + Intronic
1128894697 15:71361935-71361957 ATGCATAAAATATATCTGGAAGG + Intronic
1131348192 15:91671084-91671106 ATGCATTGGAGTCATCTGGAGGG + Intergenic
1131944250 15:97601639-97601661 ATGCACAGAAATGATATGGAAGG - Intergenic
1131970370 15:97886436-97886458 ATGCATAGAAAATGTCTGAAAGG + Intergenic
1134223288 16:12372095-12372117 ATGCATAAAAAATACCTGGAAGG - Intronic
1135388289 16:22064884-22064906 ATGTATAGAAAATATGTGGAAGG - Intronic
1135512915 16:23103492-23103514 ATGCATGGAAAAAATCTAAATGG + Intronic
1135537975 16:23309058-23309080 CAGCAAAGACATAATCTGGAGGG + Intronic
1136052731 16:27664300-27664322 ATTCATAAAAATCATCTGGTAGG - Intronic
1136135139 16:28251719-28251741 GTGCAGAGAAATGTTCTGGAAGG + Intergenic
1137261629 16:46834873-46834895 ATGCAAAGAAAAAGTCTTGAAGG - Intergenic
1138047522 16:53741279-53741301 ATGCACAGAAAAAGTCTTGAAGG - Intronic
1138603559 16:58072527-58072549 ATGCTTTGAAATAATGTGGTTGG + Intergenic
1140116839 16:72049463-72049485 ATGCACAGAGAAAATCTGAAAGG + Intronic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1142823331 17:2490111-2490133 ATGCAGAGGAAAAGTCTGGAAGG + Intronic
1144009760 17:11135799-11135821 ATGCATTGGAATCACCTGGAGGG - Intergenic
1144183960 17:12778521-12778543 AAGTATATAAATAATCCGGATGG - Intergenic
1146601828 17:34224104-34224126 AGTCATAGACATGATCTGGATGG - Intergenic
1146771769 17:35575267-35575289 ATGCTTAGAAACACTCTGGGGGG - Exonic
1148572781 17:48683761-48683783 TTGCAAAGCAACAATCTGGAAGG - Intergenic
1149400966 17:56295510-56295532 GTGCATTGGAATCATCTGGAGGG - Intronic
1149472745 17:56932202-56932224 ATGGATAAAAATGTTCTGGAAGG - Intergenic
1149804128 17:59598295-59598317 ATACATAGAAATTACCTGGAAGG + Intronic
1149842368 17:59977190-59977212 ATACATAGAAATTACCTGGAAGG - Intergenic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1151997773 17:77621178-77621200 AGACATAGAAAAAATCTGGATGG + Intergenic
1152194405 17:78908695-78908717 ATGCATAAAAATACTGTCGAGGG - Intronic
1152215695 17:79030983-79031005 AAGAAAAGAAATAATATGGAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153552273 18:6274013-6274035 ATGCATTGTAATCACCTGGAAGG - Intronic
1154343915 18:13526962-13526984 ATGAATATAGATGATCTGGATGG + Intronic
1154989185 18:21584049-21584071 ATGCATAAAATATATCTGGAAGG + Intronic
1155222380 18:23697344-23697366 ATGCATTGCAATTTTCTGGAGGG + Intronic
1156331422 18:36127720-36127742 ATGCATAGAAAATATCCTGAGGG - Intronic
1156859048 18:41815212-41815234 ATGCATAGACACACTCTCGAGGG - Intergenic
1156880991 18:42079048-42079070 ATGCAAAGAAATGTTCTTGAAGG - Intronic
1156927597 18:42601273-42601295 ATGCATGGAATATATCTGGAAGG + Intergenic
1157003182 18:43551170-43551192 AGACATTGAAATAATTTGGAGGG - Intergenic
1158021097 18:52842711-52842733 ATGCATCAAAATCACCTGGAGGG - Intronic
1158242678 18:55394688-55394710 ATGCAAAGAAATATTCTTGTCGG + Intronic
1158440944 18:57473726-57473748 GTGCATAGGAATCACCTGGAGGG - Intronic
1159268892 18:66122867-66122889 ATGCAGAGAAATAACCTGACGGG + Intergenic
1159563209 18:70017813-70017835 ATGCTTGGAAATAATATAGATGG - Intronic
1159664049 18:71135290-71135312 ATGCATAGAAATAATAGTAATGG + Intergenic
1160060194 18:75522762-75522784 ATGCATGCAAAAAAACTGGAAGG + Intergenic
1162492519 19:11002092-11002114 ATCCATGGAATTGATCTGGAAGG + Intronic
1166182479 19:41118624-41118646 TTGCACAGAAAACATCTGGATGG + Intronic
925883198 2:8369950-8369972 ATGCATGGAATTAAACTTGAAGG - Intergenic
926355129 2:12034509-12034531 ATGCATTGGAACAATCTAGAAGG + Intergenic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
927227402 2:20782240-20782262 ATGCATCAAAATCACCTGGAGGG - Intronic
927778576 2:25921261-25921283 GTTCATAGAAATCATCTGGTGGG + Intergenic
928072190 2:28227923-28227945 TTGCTTAAGAATAATCTGGAGGG - Intronic
928289410 2:30024536-30024558 ATGCATCGGAATTACCTGGAGGG - Intergenic
928816197 2:35297433-35297455 ATGCATAGATTTAACCTGAAAGG + Intergenic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
929642173 2:43593138-43593160 ATGTATAAAATAAATCTGGAAGG + Intronic
930148134 2:48028737-48028759 TTGCATCAAAATCATCTGGAGGG + Intergenic
930780318 2:55218548-55218570 AGGCATAGAAAATCTCTGGAAGG + Intronic
931155271 2:59621700-59621722 AAGCATAGAAATATTCTTCAGGG - Intergenic
931280591 2:60788179-60788201 ATGCATAGAATATCTCTGGAAGG + Intronic
932332896 2:70908393-70908415 AGGCATAAACATTATCTGGAAGG - Intronic
933334829 2:80944419-80944441 ATGCATCAGAATTATCTGGAGGG - Intergenic
935874313 2:107489132-107489154 AAGCATAGAAAGAGCCTGGATGG - Intergenic
939472968 2:142648300-142648322 ATGCATTGTAATTACCTGGAGGG - Intergenic
939842820 2:147209006-147209028 ATGCATAAAAATCAACTGGAGGG - Intergenic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
942379967 2:175379782-175379804 TTGCATAGAAAAAAGTTGGAAGG - Intergenic
942471262 2:176263007-176263029 ATGTATATAAAAAAACTGGATGG - Intergenic
942494790 2:176528627-176528649 GTGCATCCAAATAATCTAGAGGG + Intergenic
943145911 2:184044644-184044666 ATGGATAGAGATTATCTGAAGGG + Intergenic
943474290 2:188335372-188335394 ATGCAAAGAAAACATCTGAAAGG - Intronic
945222761 2:207501598-207501620 AAGCATAGAAAAAATCGGAATGG + Intergenic
945508564 2:210672028-210672050 ATGCATCAAAATCACCTGGAGGG + Intronic
946578964 2:221105672-221105694 ATGCAGAGAACTAAACTGTAAGG - Intergenic
947251063 2:228104821-228104843 ATGAATAGAAATAATGTGAATGG + Intronic
1168799069 20:632996-633018 ATGCATAGAACATTTCTGGAAGG - Intergenic
1169293467 20:4372432-4372454 ATGCACAAAAATCACCTGGAGGG - Intergenic
1172052077 20:32125558-32125580 ATGCATGGAAATTACCAGGAGGG - Intronic
1172406265 20:34692011-34692033 ATGCATAGAATTCCTCTGGAAGG + Intergenic
1172749511 20:37240398-37240420 AGGCATGGAATTAATCTTGAGGG - Intronic
1173035988 20:39410909-39410931 AGGCACAGAAAAAATCTGGAAGG - Intergenic
1173636550 20:44563953-44563975 ATGTATAAAAATATTCTGCATGG - Intronic
1175634607 20:60569928-60569950 ATCCATGGAAATAATTTGCAGGG + Intergenic
1176731754 21:10505709-10505731 ATGCATAAAATACATCTGGAAGG - Intergenic
1177232593 21:18341873-18341895 ATGCATATATATCATCTGGCAGG + Intronic
1177711750 21:24784807-24784829 ATGAATAGAATTAAACTGCACGG + Intergenic
1177732295 21:25043219-25043241 ATGAATAAAAATGATCTGTAGGG + Intergenic
1177823054 21:26052819-26052841 GTGCATAAAAATAATCTGAAGGG + Intronic
1178056263 21:28802351-28802373 ATGCATAAAGAAATTCTGGAAGG + Intergenic
1179262075 21:39766111-39766133 AGGCTTAGAATTATTCTGGATGG + Intronic
1180688930 22:17694317-17694339 TTACATAGAAATAATCAGAAAGG + Intronic
1181380015 22:22494687-22494709 ATGCATAGAAATAATCTGGAAGG - Intronic
1183690632 22:39386191-39386213 AAGCATGGAAATGGTCTGGAAGG - Intergenic
1185308229 22:50135376-50135398 ATGCATGGAAAATGTCTGGAAGG + Intronic
950051238 3:9991387-9991409 ATGAAGAGAAAAAATTTGGAAGG - Intronic
950300050 3:11868965-11868987 ATGAACAGAAAAAATTTGGAAGG - Intergenic
950650458 3:14403707-14403729 AGGAAGAGAAATAGTCTGGAGGG - Intronic
950802190 3:15561965-15561987 ATGAATACATATAATCTTGATGG - Intronic
950911830 3:16603846-16603868 ATGCATAAAAATAATCTAGAAGG + Intronic
951718791 3:25676331-25676353 ATACATATAAAGGATCTGGAAGG - Intergenic
951846580 3:27091008-27091030 ATGCATAATAATTATCTGGGAGG + Intergenic
951932127 3:27980139-27980161 AGCCATAGAAAATATCTGGAAGG - Intergenic
952653176 3:35750842-35750864 TTTCATAAAAATAGTCTGGAAGG + Intronic
952788888 3:37182539-37182561 ATACATATAAATAATCTGAATGG - Intronic
952833947 3:37588634-37588656 TTGCAAAGAAATAACCAGGAGGG + Intronic
953764055 3:45720479-45720501 TAGCATAAAAATTATCTGGAAGG - Intronic
954071719 3:48147787-48147809 ATGCATAGAAAAGGTCTAGAAGG + Intergenic
957527594 3:81397097-81397119 ATGCATAGAAATACTTAGAATGG + Intergenic
957661252 3:83156323-83156345 ATGCATTAGAATAACCTGGAAGG - Intergenic
958530899 3:95329379-95329401 ATGGAACAAAATAATCTGGATGG - Intergenic
958745601 3:98129857-98129879 ATGCAAAGAGAGAATCAGGAAGG - Intergenic
958917507 3:100066013-100066035 GTGCATTAGAATAATCTGGAAGG - Intronic
959329778 3:104988948-104988970 ATGCCTAGAAATAATCAGGTTGG - Intergenic
959389185 3:105752759-105752781 ATGCATCCAAATTATCTGAAGGG + Intronic
961232441 3:125329027-125329049 ATGTATAGAAATTGTCTGGAAGG + Intronic
961232507 3:125329933-125329955 ATGTATAGAAATTGTCTGGAAGG + Intronic
961720765 3:128894465-128894487 ATGCCTAGAAAAAGTGTGGATGG + Intronic
964046883 3:152339310-152339332 ATGGATATAAATAACCTGAATGG + Intronic
964309209 3:155374370-155374392 ATGAATACAAATAAATTGGAAGG + Intergenic
965578010 3:170237896-170237918 ATGCATAGAAAATATATAGAAGG - Intronic
966265161 3:178031606-178031628 ATGGAAAGAAAGAATTTGGAAGG + Intergenic
966582346 3:181582139-181582161 TTGCATAGAAAAATTATGGAGGG - Intergenic
967160296 3:186730948-186730970 ATGGATAGAAATAATATGGTGGG - Intronic
967680138 3:192352334-192352356 GTGCATCAGAATAATCTGGATGG + Intronic
967779051 3:193416016-193416038 CAGCACAGAAATAATCTGTAAGG + Intronic
968314480 3:197711531-197711553 AAGCATAAAAATTCTCTGGAAGG + Intronic
969947200 4:10796288-10796310 CTTCATAGAATTAATCAGGAAGG - Intergenic
970698507 4:18707309-18707331 AGGCATAAAAATAATCTGCTTGG - Intergenic
970947541 4:21712832-21712854 ATGCTTAGAAATAAAAAGGAGGG - Intronic
971519995 4:27537622-27537644 ATGTATACAAATAATTTTGATGG - Intergenic
971982508 4:33771120-33771142 ATGCATAGAAAAAATGTAGGTGG - Intergenic
972279912 4:37591906-37591928 ATGTAAAGAACTAATCTAGATGG + Intronic
973157338 4:46973134-46973156 ATACATGGAAATAATTTAGAAGG + Intronic
973627437 4:52787128-52787150 ATGCATAAAAAATAACTGGAAGG + Intergenic
975031523 4:69624739-69624761 ATACATAGAAGTAAACTGTATGG - Intronic
975314576 4:72936809-72936831 AAGCACAGAAATAATTTGGAAGG - Intergenic
975995314 4:80307273-80307295 ATGCTTAGAAATGAAGTGGATGG - Intronic
977915143 4:102584002-102584024 ATGCATAAAGAAATTCTGGAAGG + Intronic
978084680 4:104636018-104636040 ATGGAGAGTAATAATCTTGAGGG - Intergenic
978414006 4:108456699-108456721 ATGAATAGAAAAAATAGGGAAGG - Intergenic
978594631 4:110363721-110363743 ATGCATAGACATTTTCAGGAAGG - Intergenic
978881374 4:113707267-113707289 ATGCAGAGAAATAAAAAGGAAGG + Intronic
979429557 4:120612220-120612242 CTGCAGAGAAATTATCTGGAAGG - Intergenic
980907752 4:138964649-138964671 ATATATAGAAAAAGTCTGGAGGG - Intergenic
981121974 4:141062432-141062454 ATGCATATAAAGCATCTAGAAGG + Intronic
981363763 4:143877421-143877443 ATGCATAAGAATACTGTGGAAGG - Intronic
981374493 4:143998197-143998219 ATGCATAAGAATACTGTGGAAGG - Intronic
981384819 4:144117509-144117531 ATGCATAAGAATACTATGGAAGG - Intronic
981863242 4:149382063-149382085 ATGCTTCGAAATACTATGGAGGG - Intergenic
982870245 4:160570646-160570668 AAGCCTAGAAATAATTTGAATGG + Intergenic
982925668 4:161334528-161334550 ATGCAGTGAAATCCTCTGGATGG - Intergenic
983089217 4:163484749-163484771 ATGCATAGAAAATATGTGGATGG - Intergenic
984774441 4:183468210-183468232 TTACATAGAAAAAATCTGCAAGG + Intergenic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
985981993 5:3477840-3477862 TTGCATAGAGATAAATTGGAAGG - Intergenic
986581101 5:9266367-9266389 ATGGAAATAAATGATCTGGAGGG + Intronic
986843563 5:11726404-11726426 ATTCATATAAAAAGTCTGGAAGG + Intronic
987724270 5:21677499-21677521 AGGCAAAGAAAAAATCTTGAGGG - Intergenic
988871326 5:35393488-35393510 ATGCATAGAAAACCTCTGGAAGG - Intergenic
988961260 5:36373825-36373847 ATGCAAAGTTATAATCAGGAGGG + Intergenic
990851999 5:60215777-60215799 ATGTGTACAAATCATCTGGACGG - Intronic
991196295 5:63936480-63936502 ATGCAAAGAAAAAATCTTCAAGG + Intergenic
991666358 5:69003799-69003821 ATGTATAGAATTTGTCTGGAAGG + Intergenic
993436132 5:87897316-87897338 ATTCATACAAATATTTTGGACGG + Intergenic
993448991 5:88051023-88051045 ATGCTTACAAATAATTTAGATGG + Intergenic
994153048 5:96472257-96472279 ATGACTAGATTTAATCTGGAAGG + Intergenic
994404180 5:99322700-99322722 ATGCCTGGAAAAATTCTGGAAGG - Intergenic
994706483 5:103212997-103213019 ATACATACATATAATCTAGAAGG + Intergenic
994735043 5:103542717-103542739 ATGCTTAGAATTAATCTGTCAGG + Intergenic
996225515 5:120989213-120989235 ATGCATTAAAATCACCTGGAGGG - Intergenic
996470412 5:123853473-123853495 ATACAGAGAGATTATCTGGATGG + Intergenic
997275189 5:132580984-132581006 ATGCATAGAAATATATTGCAAGG + Intronic
998288360 5:140886410-140886432 ATGAATAGAAATAATATAGGAGG - Intronic
1000298372 5:159932688-159932710 ATGCATAGAACATATCTGGAAGG - Intronic
1000299465 5:159942770-159942792 ATACATAGAAAAAAACTGGAAGG + Intronic
1000489746 5:161896622-161896644 ATGTTTAGAAATAATCTAGAAGG + Intronic
1001232646 5:170002451-170002473 ATGCATAAAAAAATTCTGAAAGG + Intronic
1001583554 5:172817294-172817316 ATGCAGAGAAAAAAGTTGGAAGG + Intergenic
1001633042 5:173190816-173190838 ATGCATGTAAAAAACCTGGAGGG + Intergenic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1003306543 6:4934160-4934182 ATCCATGGAGATACTCTGGAGGG + Intronic
1003467438 6:6394272-6394294 ATGCATAGAAACTTTCTAGATGG - Intergenic
1005531546 6:26711675-26711697 GTGCAAAGAAATAATCTTGTTGG + Intergenic
1005539249 6:26789987-26790009 GTGCAAAGAAATAATCTTGTTGG - Intergenic
1007499277 6:42283413-42283435 ATTCATAAAGAAAATCTGGAAGG + Intronic
1008067274 6:47062641-47062663 ATGCTCAGAAACACTCTGGAAGG + Intergenic
1008432139 6:51431411-51431433 ATGTATATAAATAATCTGATAGG - Intergenic
1008911991 6:56744412-56744434 TTGTGTAGAAATAATATGGAGGG + Intronic
1009010082 6:57832206-57832228 GTGCAAAGAAATAATCTTGTTGG - Intergenic
1009012919 6:57864503-57864525 GTGCAAAGAAATAATCTTGTTGG - Intergenic
1009400370 6:63247478-63247500 ATGCACAGAAAATATCTAGAAGG - Intergenic
1009862946 6:69358309-69358331 ATGCATCAAAATTATCTGGATGG - Intronic
1011229065 6:85139510-85139532 GTGCATAAAAATCATCTGGGGGG - Intergenic
1011230605 6:85157434-85157456 AGGCATTTAAACAATCTGGATGG - Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1011801479 6:91020918-91020940 ATGCAGAGAAATAAACTACATGG - Intergenic
1012612479 6:101232744-101232766 ATGCATAAAAAAGAGCTGGAAGG - Intergenic
1013040549 6:106429064-106429086 ATGGATAAAACTAATCTGTAAGG + Intergenic
1013140076 6:107324641-107324663 ATGCAAACAAAGAGTCTGGAAGG - Intronic
1014175073 6:118323387-118323409 ATCCAAAGAAATATTCTTGAGGG + Intergenic
1014204364 6:118640902-118640924 ATGCATAGAAATTTTCCAGAAGG + Intronic
1014950881 6:127554205-127554227 ATGCATAGAAAGAATACGGAAGG + Intronic
1015225004 6:130847357-130847379 ATGCATAAAAATAATGTTCAGGG - Intronic
1015618481 6:135104680-135104702 ATGTGTAGAAAAAAGCTGGATGG - Intergenic
1015908390 6:138141697-138141719 ATACATAGGAAAAATCTGGAAGG - Intergenic
1017509641 6:155102623-155102645 ATGCAAAGATATATTCTTGAGGG - Intronic
1017742844 6:157422134-157422156 ATGCCTGGAAATGCTCTGGATGG - Intronic
1017761028 6:157568365-157568387 ATGCAGAGAAAAAAACTGGAAGG - Intronic
1019163405 6:170083846-170083868 ATGCATTGAAATAATCAGAGAGG + Intergenic
1019169952 6:170128011-170128033 ATGCATAGGAAAAGTCTGCAAGG + Intergenic
1020705794 7:11542564-11542586 CTGCTTAGAGACAATCTGGATGG + Intronic
1020743693 7:12054552-12054574 ATGCATCAGAATTATCTGGAAGG - Intergenic
1020808283 7:12818584-12818606 ATTCATAAGAACAATCTGGAAGG + Intergenic
1022160692 7:27708103-27708125 ATGCATGGAAATAATCTGGAAGG + Intergenic
1022280684 7:28906184-28906206 ATACATAGAAAAATTCAGGAAGG + Intergenic
1022282104 7:28921491-28921513 ATACATAGAAAAGATCTAGAAGG - Intergenic
1023018229 7:35986670-35986692 ATTCATATAAATTATCTGGGCGG - Intergenic
1023320083 7:38986795-38986817 ATGCACAGAAAATCTCTGGAAGG - Intronic
1023412016 7:39897458-39897480 ATGCATAGAATACCTCTGGAAGG - Intergenic
1023471486 7:40526448-40526470 ATGCATTAAAATAATCTTTAGGG + Intronic
1024386722 7:48760560-48760582 ATTCATAGATATATTCTGAATGG - Intergenic
1028031823 7:85925191-85925213 ATCAATAGAAATAATTTAGAAGG - Intergenic
1028311040 7:89336295-89336317 ATGCATATAAATCATGTAGAGGG + Exonic
1029982564 7:104892778-104892800 GTACATAGAAAAAATATGGAAGG - Intronic
1030287423 7:107840692-107840714 ATGGATAGAAAGAATCAGTATGG + Intergenic
1030745231 7:113157436-113157458 ATGCTTAGAAAAAGTCTAGAAGG - Intergenic
1031203172 7:118717842-118717864 ATGCCTTGGAAAAATCTGGAAGG + Intergenic
1031541885 7:123005011-123005033 AAGCATAAAAATCACCTGGAAGG - Intergenic
1031714891 7:125096914-125096936 ATGAATAGAAATAATATGCATGG + Intergenic
1031950857 7:127890620-127890642 AAGCATGGAAATAATTTGCAGGG + Intronic
1032009476 7:128334202-128334224 ATACAAAGAAAATATCTGGAAGG + Intronic
1033026310 7:137776518-137776540 ATGCTTAGAAAAAATATAGAAGG + Intronic
1033388143 7:140899330-140899352 ATGCATCAAAGTCATCTGGAGGG - Intronic
1034597836 7:152215760-152215782 ATGCATAAAACACATCTGGAAGG + Intronic
1035053322 7:156017117-156017139 AGGCATAGTTATAATCTGGGGGG + Intergenic
1035700120 8:1632041-1632063 AAGAAGAGAAATAATCTGAATGG + Intronic
1035816323 8:2545043-2545065 ATGCAAAGCAAAACTCTGGACGG + Intergenic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1036976008 8:13413522-13413544 ATGCACAAAATAAATCTGGAAGG + Intronic
1038099072 8:24351609-24351631 TTGCAAAGAAATAAGCTAGAGGG - Intronic
1040583252 8:48715116-48715138 ATGCATTGTAAAAGTCTGGAAGG + Intronic
1040619577 8:49075916-49075938 ATGCATAAAGATAGACTGGAAGG + Intronic
1041908757 8:63064938-63064960 ATGCATAGAAGGGATTTGGAAGG - Intronic
1042013537 8:64279737-64279759 ATGCTTAGAAATGATTTGGTAGG + Intergenic
1042556018 8:70034464-70034486 ACACGTAGACATAATCTGGATGG + Intergenic
1043101672 8:76055037-76055059 CTGCAAAGAGATAATGTGGAAGG - Intergenic
1043323825 8:79025177-79025199 ATGCATCAAAATCAACTGGAAGG + Intergenic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1044585357 8:93864583-93864605 ATGCATAGAAGAAATCTGGAAGG - Intronic
1044800471 8:95948793-95948815 ATGCATAGAAATACTGGGGAAGG - Intergenic
1045056727 8:98374820-98374842 ATACATAAAGATACTCTGGAAGG + Intergenic
1045400917 8:101817018-101817040 ATGGATAGAAACACTCTGAAGGG - Intronic
1045996954 8:108374196-108374218 ATGCATAGAAAATGTCAGGAAGG - Intronic
1045997113 8:108375954-108375976 ATGGATAGAAAAAATCAGTATGG - Intronic
1046713693 8:117543993-117544015 AGGCATGGAAAGAATCTTGAAGG + Intergenic
1047322862 8:123804626-123804648 ATGCATAAAGACACTCTGGAAGG - Intronic
1047943142 8:129846759-129846781 ATGTACAGAAAAAATCTGTAAGG - Intronic
1048065697 8:130966253-130966275 ATGCATAGACATAAGGTGCAAGG - Intronic
1048862416 8:138733722-138733744 AAGCACAGGATTAATCTGGAAGG - Intronic
1050005658 9:1127565-1127587 ATGTGTAGAAAAAATTTGGAGGG + Intergenic
1051246035 9:15112296-15112318 GTGCATAGGAATAAACTAGAAGG - Intergenic
1051263995 9:15293624-15293646 GTGCATAGAAATCACCTGGCTGG - Intronic
1051587757 9:18745254-18745276 ATGCTTATTAATAATCTAGAAGG - Intronic
1055086247 9:72317006-72317028 ATGCATAAAAATAGACTGGGAGG - Intergenic
1055111757 9:72566754-72566776 GTGGATAGAATCAATCTGGAGGG - Intronic
1055491112 9:76806240-76806262 TTGCATAGGAGTCATCTGGAGGG - Intronic
1055744362 9:79426755-79426777 AGTCATAGAAACAACCTGGATGG - Intergenic
1055753004 9:79527982-79528004 ATGCACTGGAATCATCTGGAGGG + Intergenic
1057281944 9:93719640-93719662 ATGCATAGAGAAAACCTGGAAGG - Intergenic
1057601850 9:96465004-96465026 AGGCATAGTACTAATCTGAATGG - Intronic
1057994919 9:99813043-99813065 ATGCATTAAAAAACTCTGGAAGG + Intergenic
1060249555 9:121974457-121974479 ATGCATTTAAAAAAACTGGAAGG - Intronic
1060691256 9:125662909-125662931 TTGCTTAAAAATAATCTGGGAGG + Intronic
1186332763 X:8553516-8553538 ATGCATAGAAAATTTCTGAAAGG + Intronic
1186671656 X:11773284-11773306 GTCCATAGACATCATCTGGAAGG - Intronic
1187629352 X:21151399-21151421 ATACATAGAAATAATTTGTGTGG - Intergenic
1190211902 X:48455599-48455621 ATGCGTAAAAATTATCTGGGAGG + Intergenic
1191638148 X:63400598-63400620 TTGCCTAGAATTAATCTGCAAGG + Intergenic
1191952063 X:66603181-66603203 ATCAATATAAATAATCTAGAGGG + Intronic
1193410869 X:81161226-81161248 ATTTATAGAAATAATTTTGAGGG - Intronic
1193713681 X:84910187-84910209 ATCCATCAAAATAAACTGGAGGG + Intergenic
1194665523 X:96673524-96673546 AGGCAGATAAATAATCTAGAAGG - Intergenic
1194763330 X:97819870-97819892 GTACATAAAAAAAATCTGGAGGG + Intergenic
1195278069 X:103301827-103301849 ATGCATAGGAAGACTCTGAAAGG - Intergenic
1195596824 X:106700715-106700737 ATGAATAGAAAAAGTCTGAAAGG - Intronic
1195812279 X:108847709-108847731 ATGAAAAGAACAAATCTGGAGGG + Intergenic
1196199720 X:112871880-112871902 ATGGACAGAAATATTCTTGATGG + Intergenic
1196939702 X:120763023-120763045 ATGCATTGGAATCACCTGGAGGG + Intergenic
1197632617 X:128879058-128879080 CAACATAGAAATAATCTGCAAGG - Intergenic
1201169736 Y:11246325-11246347 TTTCTTAGAAATATTCTGGAAGG - Intergenic
1201687946 Y:16728126-16728148 ATGCTTATACATAATCTCGAGGG + Intergenic
1201746339 Y:17378299-17378321 AGTCATAGAAATAATCTATATGG + Intergenic