ID: 1181380379

View in Genome Browser
Species Human (GRCh38)
Location 22:22497569-22497591
Sequence AATGATGTAAAGAGGGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181380379 Original CRISPR AATGATGTAAAGAGGGGTTG TGG Intronic
904399407 1:30246244-30246266 AATGATGGAAGGAGGAGTGGAGG + Intergenic
904941419 1:34166688-34166710 AAGGGTGTGAAGAGGGGCTGTGG + Intergenic
905774653 1:40660780-40660802 AAAGGTGGGAAGAGGGGTTGGGG + Intronic
906704718 1:47886620-47886642 AATGATTAAAAGAGGGGTTGGGG - Intronic
906843654 1:49166651-49166673 AAGGATGTAAAGAGGACTAGTGG - Intronic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
908026621 1:59958662-59958684 AATGATGAAAAGAGGACATGTGG - Intergenic
908602323 1:65754134-65754156 ATTGGCATAAAGAGGGGTTGTGG - Intergenic
908617420 1:65937739-65937761 GATGAGGTAAAGCAGGGTTGAGG - Intronic
908781530 1:67695348-67695370 GAGGATGTAAATAGGGGGTGGGG + Intergenic
909554406 1:76937488-76937510 GATGGTGTAAGGAAGGGTTGAGG + Intronic
909736059 1:78963326-78963348 AAAGAAGCAAAGAGGTGTTGGGG - Intronic
910532325 1:88251660-88251682 TATGCTTTAAAGAGGGGTTGAGG - Intergenic
910694837 1:90000994-90001016 AATGAAGTTAAGAGGTGATGGGG + Intronic
912514392 1:110209156-110209178 GATGATGTAAAGAGATCTTGAGG - Intergenic
912524695 1:110272704-110272726 AAAGAGAAAAAGAGGGGTTGGGG + Intronic
912540243 1:110409399-110409421 AATGATCCACAGAGGGGGTGAGG - Intergenic
914349023 1:146823604-146823626 AATGATGAAAATAGGGAATGGGG + Intergenic
916521740 1:165569606-165569628 AGTGAGGTAAAGAGGTGGTGGGG - Intergenic
917281384 1:173380649-173380671 AGTGATTGAAAGAGGGGATGAGG - Intergenic
919872332 1:201831697-201831719 TTTCATGTAAAGAAGGGTTGAGG - Intronic
920658358 1:207893380-207893402 AATTATATTAAAAGGGGTTGGGG - Intronic
920775536 1:208933077-208933099 AATGCTGTGAAAAGAGGTTGTGG - Intergenic
922083957 1:222327211-222327233 AATTTTAAAAAGAGGGGTTGTGG - Intergenic
1062928347 10:1335224-1335246 AATGATGGAAGGAGGGATGGAGG + Intronic
1065867064 10:29923543-29923565 AATGAGGTGAAGAGGGTGTGTGG + Intergenic
1066437048 10:35405003-35405025 AATGAGTTATGGAGGGGTTGTGG + Intronic
1066657639 10:37710905-37710927 AGTGCTGTAGAGAGGGGTAGGGG - Intergenic
1067691162 10:48503239-48503261 AATGTTCAAGAGAGGGGTTGTGG + Intronic
1067777669 10:49175150-49175172 AAGGAGGTACAGAGGGCTTGAGG + Intronic
1068459747 10:57311951-57311973 AATCATCCAAAGAGGAGTTGAGG - Intergenic
1069059092 10:63874843-63874865 AATGTTGTAAAGTGAGATTGTGG + Intergenic
1069303107 10:66933190-66933212 AATGATGTAAAATGGGCTTGGGG - Intronic
1071423883 10:85528999-85529021 AATGTTGAAAAGAGGTGGTGAGG + Intergenic
1073214518 10:101829241-101829263 AGTGATTTGAAGAGGGGTCGCGG - Intronic
1074295347 10:112182899-112182921 AATGAAGTGAAGAGAGGATGAGG + Intronic
1078723201 11:13903021-13903043 CACGATGTAAAGATGGGTTTCGG + Intergenic
1079939970 11:26668245-26668267 AATGAGTTAAAGAGGTATTGAGG + Exonic
1080517960 11:33040671-33040693 GATGATGGAAAGATGCGTTGGGG - Intronic
1081638731 11:44738423-44738445 AATGAGGCACAGAGAGGTTGAGG - Intronic
1081852909 11:46285988-46286010 AATGAGGTAAAGAAGGGTGAGGG - Intronic
1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG + Intronic
1084508150 11:69583559-69583581 AATGATGAAAAGAAGATTTGGGG + Intergenic
1084862431 11:72028819-72028841 AAGGCTGCAAAGAGGGCTTGTGG + Intronic
1086117918 11:83272968-83272990 AATGAAGCACAGAGGGGTTAAGG - Intronic
1086502164 11:87464595-87464617 AATGGAGGAAAGAGTGGTTGGGG + Intergenic
1087711643 11:101560415-101560437 TCTGATGTAAAGGAGGGTTGGGG - Intronic
1088736624 11:112732909-112732931 CATGAAGTAAAGAGAGGCTGGGG - Intergenic
1089487565 11:118858761-118858783 AATGATGTTAAGAGGAATTCAGG - Intergenic
1089591225 11:119541941-119541963 AATGAGGTAAGGAGGGAATGGGG + Intergenic
1089773731 11:120821433-120821455 AAAGATGGAAAGAGAGGCTGGGG + Intronic
1091079358 11:132652223-132652245 AATGATGTAGAGAGGCTGTGAGG - Intronic
1091873991 12:3918699-3918721 GATCATGTAAAGAGGTGGTGTGG - Intergenic
1092115983 12:6006102-6006124 AATAATGTAAAGTGGGGGAGAGG + Intronic
1094286403 12:28799029-28799051 AATGTTGTGAAGAGGGGAGGAGG + Intergenic
1099318143 12:81110548-81110570 AATGATTTAAAGAGAGGTAATGG + Intronic
1100178295 12:92055993-92056015 AATGATGTAAAGATACGTTTAGG - Intronic
1100283239 12:93138652-93138674 CATGATGAAAAGAGGGCTTTTGG - Intergenic
1101698982 12:107153888-107153910 AAAGAAGTGAAGAGGGTTTGGGG - Intergenic
1101815802 12:108145209-108145231 AATTAGGTGAAGAGGGGTGGGGG - Intronic
1103013402 12:117475382-117475404 AATAATATATAGAAGGGTTGGGG - Intronic
1104285571 12:127421439-127421461 CCTGAAGCAAAGAGGGGTTGAGG + Intergenic
1105768415 13:23583711-23583733 AATGGTGTAAAGAGTGGTTTTGG + Intronic
1107309742 13:39063486-39063508 AATGACGTAAAAAGGTGATGAGG + Intergenic
1108830093 13:54466750-54466772 AATGATGTAAAGATAGATAGTGG + Intergenic
1108888929 13:55228639-55228661 CTAGAAGTAAAGAGGGGTTGTGG - Intergenic
1110422064 13:75322443-75322465 AATGAGGTATAGAGGGCTTTGGG + Intronic
1111141358 13:84123693-84123715 AAGGATATAAAGATGGATTGGGG + Intergenic
1115714842 14:36092002-36092024 AATGATCTAAATAGGTGTTTAGG + Intergenic
1116279914 14:42891692-42891714 AATGATATAAAAAGGAGATGGGG - Intergenic
1116321521 14:43471844-43471866 AATGAGTTAAAGAGGATTTGGGG - Intergenic
1117047644 14:51828959-51828981 AATGGTGACAAGAGGGTTTGGGG - Intronic
1117354709 14:54912810-54912832 AATGATGTACAGAGTAGTTAAGG - Intergenic
1121430514 14:93883297-93883319 ACTGAAGGAAAGTGGGGTTGAGG + Intergenic
1122664478 14:103319180-103319202 AAGGCTGTGAGGAGGGGTTGGGG - Intergenic
1126309315 15:47297938-47297960 AATGAGGGATAGAGGAGTTGTGG + Intronic
1126977063 15:54195264-54195286 AATGATGTAAACAGGGGTGTAGG - Intronic
1128254111 15:66184667-66184689 AGGGGTGGAAAGAGGGGTTGAGG - Intronic
1129234197 15:74214047-74214069 AAGGAAGTAAAGTGGGGGTGGGG + Intergenic
1129907372 15:79197930-79197952 TCTGATGTTAGGAGGGGTTGAGG + Intergenic
1132366541 15:101261869-101261891 ACTGAACCAAAGAGGGGTTGTGG - Intergenic
1135097221 16:19574508-19574530 AATGAAGAGAAGAGGCGTTGAGG - Intronic
1135591053 16:23705544-23705566 AATGATGGAATCAGGGCTTGAGG + Intronic
1139985010 16:70891951-70891973 AATGATGAAAATAGGGAATGGGG - Intronic
1141397648 16:83719064-83719086 AATGATTTTAAGAGGCATTGAGG - Intronic
1147350697 17:39840874-39840896 AATGAGGTAAGGAGGGTTTCAGG + Intronic
1148892668 17:50819435-50819457 AATGATGTAATGATCTGTTGAGG + Intergenic
1149926586 17:60707495-60707517 AATGATGTAAAGATTGGAAGGGG - Intronic
1149984944 17:61340245-61340267 AGTGATGGCAAGAGGGGGTGGGG + Intronic
1150130848 17:62667967-62667989 AAAGATATAAAGAGGTGTGGGGG + Intronic
1151178571 17:72309363-72309385 AATGTTGAATAGAGGGGTTGGGG + Intergenic
1151509626 17:74550270-74550292 AATGATCAGAAGAGGGTTTGTGG - Intergenic
1152134402 17:78495334-78495356 AGTGATGGAAAGCAGGGTTGGGG - Intronic
1153050740 18:901287-901309 AATGATGAAAGAGGGGGTTGGGG - Intergenic
1157958032 18:52120901-52120923 AATGATGAAAAGAGAGTTTGGGG - Intergenic
1159013231 18:63079256-63079278 AAGGATGTAACCAGGTGTTGGGG - Intergenic
1162150757 19:8643993-8644015 AATGAGGGAAGGAGGTGTTGGGG - Intergenic
1162639308 19:11995463-11995485 AATAATGGAAACTGGGGTTGAGG - Intergenic
1162660433 19:12164195-12164217 AAGGATGGAAACTGGGGTTGGGG - Intronic
1162806247 19:13139317-13139339 AATTATGTACAGGGGGGTGGGGG - Exonic
1165105525 19:33467642-33467664 TATGATGAAAAGATGGGTGGAGG + Intronic
1165249744 19:34520333-34520355 AATGACTTGAAGTGGGGTTGGGG + Intergenic
926583668 2:14661437-14661459 ATTGATGAACACAGGGGTTGGGG - Intergenic
926643171 2:15259484-15259506 ACTGCTGTAAAGAGGGGTTGAGG - Intronic
928638418 2:33272189-33272211 AATGACCTAAATTGGGGTTGAGG - Intronic
928732768 2:34251799-34251821 AATGGTGTACAGAGGAGGTGAGG - Intergenic
928989328 2:37215809-37215831 AATTATATACATAGGGGTTGTGG + Intronic
931705571 2:64943885-64943907 GATTATGTAAAGGGGGGATGCGG + Intergenic
932684212 2:73854212-73854234 AATGATGTCTGGAGGAGTTGAGG + Intronic
933090376 2:78110061-78110083 AATGATATTAATTGGGGTTGAGG + Intergenic
933500528 2:83105255-83105277 TAGGTTGTAAAGAAGGGTTGAGG - Intergenic
933737532 2:85507202-85507224 AAACATGTAAAGAGCGGTTAGGG - Intergenic
934077718 2:88442041-88442063 AAGGAAGTAAAGGGGGGTGGGGG + Intergenic
934647829 2:96069399-96069421 GAAGAAGTAAAGAGGGGGTGGGG - Intergenic
934841201 2:97625220-97625242 GAAGAAGTAAAGAGGGGGTGGGG - Intergenic
935834043 2:107030994-107031016 AATGCTGTAAAAATGGATTGGGG + Intergenic
935835344 2:107045644-107045666 TATGATGTCAAGAGGCATTGAGG + Intergenic
937158458 2:119738294-119738316 AATGATGTTAAGAGAGGGTGGGG + Intergenic
937394803 2:121525448-121525470 AATGATTGAAAGAGGGTCTGAGG - Intronic
939107014 2:137960977-137960999 TATGGTGTAAAGAAGGGATGCGG - Intergenic
942328479 2:174796166-174796188 AGGTATGGAAAGAGGGGTTGGGG + Intergenic
943684225 2:190800121-190800143 AATGATGGAATGGGGTGTTGGGG - Intergenic
945064151 2:205934322-205934344 AATGATGTATGGTAGGGTTGGGG - Intergenic
945951622 2:216044376-216044398 AGTGATGGAAAATGGGGTTGTGG - Intronic
946542715 2:220702877-220702899 AATGAAATAAAAAGTGGTTGGGG + Intergenic
947659432 2:231855639-231855661 AATGATAGAAAGAGGAGATGTGG - Intergenic
1170195644 20:13686749-13686771 AAGGCTGTGAAGAGGGGATGGGG - Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177385850 21:20408504-20408526 CATGATGGGAAGGGGGGTTGAGG + Intergenic
1177406483 21:20674296-20674318 AATGAGGGAAAGTGGGGGTGGGG - Intergenic
1177889704 21:26790798-26790820 AATGGTGTAAAAATGTGTTGGGG + Intergenic
1178980357 21:37258349-37258371 AACACTGAAAAGAGGGGTTGCGG - Intronic
1179458902 21:41520451-41520473 AATGATGATTAGAGGGCTTGAGG - Intronic
1181170814 22:21008865-21008887 CATGTTGTACAGAGGGGATGTGG - Intergenic
1181380379 22:22497569-22497591 AATGATGTAAAGAGGGGTTGTGG + Intronic
1183780094 22:39994312-39994334 AATGATGTAAAGAGCAGCAGTGG - Intergenic
1184031498 22:41897572-41897594 ACTGATGTGATGAGGGGCTGAGG - Intronic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1185002418 22:48253974-48253996 AATTATGAAAGGAGGGGTTATGG + Intergenic
952779945 3:37086719-37086741 AATGTTCTAAAGATGGGTTGTGG + Intronic
956943151 3:74187551-74187573 TATGATTTAAAGAGGCTTTGAGG + Intergenic
957164648 3:76656812-76656834 GATGAAGTAAAAAGGGGTTTAGG - Intronic
957197643 3:77090652-77090674 AATGCTATAAAGAGTGGTTTAGG - Intronic
957327018 3:78709142-78709164 AATGATGTAATGTGAGGTTCAGG + Intronic
957599884 3:82320444-82320466 AATGAAATAAAGAGGGCATGAGG - Intergenic
958428667 3:94011188-94011210 AAATATGTCAAGAGAGGTTGAGG - Intronic
958907305 3:99956262-99956284 AAAGATGTGAAGAGGTGTTGGGG - Intronic
959335958 3:105065878-105065900 TATGATGGAAAGAGGCATTGGGG + Intergenic
961348920 3:126286785-126286807 CATGATGGGAAGAGGGGTGGTGG - Intergenic
962351542 3:134660037-134660059 AAGGATGAAATGAGGGGATGAGG + Intronic
963928165 3:150973581-150973603 ATTGATGGAAAGAGGGATGGTGG + Intergenic
964534081 3:157700363-157700385 CATGGTGTAAAGAGGGTGTGGGG - Intergenic
964587357 3:158321174-158321196 AAAGAAGGAAAGAGAGGTTGAGG - Intronic
971144497 4:23962098-23962120 AAAGATGAGAAGAGGGGTTATGG - Intergenic
971485391 4:27154991-27155013 AATGTTCGACAGAGGGGTTGTGG - Intergenic
974980620 4:68953045-68953067 AATGATGAGAAGTGGGGTGGTGG + Intergenic
974997592 4:69180391-69180413 AATGATGGGAAGTGGGGTGGTGG - Intronic
975002461 4:69241359-69241381 AATGATGGGAAGTGGGGTGGTGG - Intergenic
975007436 4:69308414-69308436 AATGATGGGAAGTGGGGTGGTGG + Intronic
975010566 4:69345341-69345363 AATGATGGGAAGTGGGGTGGTGG - Intronic
975074113 4:70183201-70183223 AATGTTGTCATGAGGGTTTGGGG + Intergenic
975698986 4:77043627-77043649 AAAGAGGGAAGGAGGGGTTGGGG - Intergenic
977884936 4:102243769-102243791 AGTGATTGAAAGAGGGGATGAGG - Intergenic
979307625 4:119165623-119165645 TAGAATTTAAAGAGGGGTTGAGG + Intronic
981799795 4:148642173-148642195 AAAGATGCAAGGAGGGGTGGAGG - Intergenic
981888007 4:149701032-149701054 AAGCATGTAAAGAGGGATTTGGG - Intergenic
983350453 4:166581039-166581061 AGTGATGAAAAGAATGGTTGGGG - Intergenic
985171378 4:187153739-187153761 ACTGAGGCAAAGAGAGGTTGAGG + Intergenic
986842496 5:11714262-11714284 AAACATTTAAAGAGGTGTTGAGG - Intronic
987445101 5:18007141-18007163 AATGATTTAAATAGTTGTTGAGG + Intergenic
989506529 5:42231890-42231912 AAAATTGTAAACAGGGGTTGGGG - Intergenic
992152247 5:73916576-73916598 ACTGATATAAAGAGAGATTGGGG - Intronic
993806839 5:92420915-92420937 TATGATGAAGAGAGGTGTTGTGG + Intergenic
993914544 5:93727004-93727026 AATGATGGAAGGAGGGGTAGTGG + Intronic
996802051 5:127415144-127415166 AATGATGAAAGAAGAGGTTGAGG + Intronic
997035246 5:130183107-130183129 AAGGAAGAAAAGAGGGGATGAGG - Intronic
999596261 5:153208168-153208190 AATGATGGCAAGAGGTGCTGGGG + Intergenic
1001563070 5:172682849-172682871 ACTGAGGCACAGAGGGGTTGGGG - Intronic
1003594384 6:7461391-7461413 CATGATCTGAAGAGGGCTTGTGG + Intergenic
1010013981 6:71083124-71083146 CATGATGTTTGGAGGGGTTGAGG + Intergenic
1010184323 6:73125386-73125408 AATGATGTGAAGAGTGGCAGAGG + Intronic
1010819896 6:80401374-80401396 AATAATTTAAAAAGGGGTCGGGG - Intergenic
1011125279 6:84000763-84000785 AATGATGTAAGGATGTGATGCGG - Intergenic
1011629700 6:89311755-89311777 GATGATGTGAAGATGGGGTGAGG - Intronic
1013603455 6:111726470-111726492 AGGGAGGAAAAGAGGGGTTGGGG + Intronic
1014177939 6:118350404-118350426 ACTGATGTCTAGAGAGGTTGGGG - Intergenic
1014670582 6:124300097-124300119 AACCATGTAAAGAGGAATTGGGG - Intronic
1014843630 6:126249321-126249343 AATAATGAATAGAGGGGTGGGGG - Intergenic
1015052948 6:128863778-128863800 TATTATGTAAACAGGGATTGAGG - Intergenic
1015538115 6:134286910-134286932 ATTTAGGTAAAGAGAGGTTGGGG + Intronic
1016849176 6:148599670-148599692 AATGATGTAAGGAGATGTTTTGG + Intergenic
1022809208 7:33852256-33852278 CATGATGTTAAGTGGAGTTGAGG - Intergenic
1023042824 7:36187142-36187164 AAGGAGGTAAAGAGGAGTTGAGG - Intronic
1023237432 7:38105357-38105379 ACTGATGTAAAGTGGGGATGAGG - Intergenic
1024284372 7:47744481-47744503 AATGATGGATGGAAGGGTTGAGG + Intronic
1024560284 7:50639094-50639116 AAAGATGGAAGGAGGGGGTGAGG + Intronic
1024774508 7:52767097-52767119 AATAATGAAAACAGGAGTTGAGG + Intergenic
1025209647 7:57013397-57013419 TAGAATGTAAGGAGGGGTTGGGG - Intergenic
1026474402 7:70722142-70722164 AAAGATTTTAAAAGGGGTTGGGG - Intronic
1027516155 7:79144853-79144875 AAAGATAAATAGAGGGGTTGGGG - Intronic
1027658632 7:80962290-80962312 AACAATGTGAAGAGGGGGTGGGG + Intergenic
1028033421 7:85948717-85948739 AAAGATAGAAAGAGGGATTGGGG - Intergenic
1029326822 7:99816939-99816961 AATGATGGGAAGAGGGCTTCAGG - Intergenic
1031455894 7:121979191-121979213 AAAGAAAGAAAGAGGGGTTGAGG - Intronic
1031484728 7:122312760-122312782 AATGTGGGAAGGAGGGGTTGGGG - Intergenic
1031704447 7:124963135-124963157 AATGGGTTACAGAGGGGTTGTGG + Intergenic
1033821441 7:145139115-145139137 AAAGATGTACGGAGGGGTTAGGG + Intergenic
1037559632 8:20061194-20061216 AAAGATGTGAAGAGAGGTAGAGG + Intergenic
1038736192 8:30171818-30171840 AATGTTTGAAAGAGGGATTGTGG - Intronic
1039575613 8:38621564-38621586 AATGCTGTAATGAGGGGTGGTGG - Intergenic
1039685304 8:39795289-39795311 CATGATGGGAAGAGGGGTGGGGG + Intronic
1040491564 8:47928129-47928151 AATTATGTTAAGAGAGCTTGAGG + Intronic
1042312258 8:67390766-67390788 AAGGCTGTAAAGAGAGGTCGGGG + Intergenic
1042541821 8:69915168-69915190 GATGATTTAAAAAGGGCTTGAGG - Intergenic
1043755567 8:83999984-84000006 AATGATGTCAGCAGGAGTTGTGG + Intergenic
1046971382 8:120227391-120227413 GATGGGGTAAAGAGGGATTGTGG - Intronic
1047271718 8:123366904-123366926 AAAGAGGAAAAGAGGGGCTGAGG + Intronic
1047551044 8:125872572-125872594 AAAGAGGAAAAGAGGTGTTGGGG - Intergenic
1047869288 8:129064697-129064719 AATGGTGTTACCAGGGGTTGAGG + Intergenic
1048445467 8:134489657-134489679 GATGATGGAAGGAGGGGATGTGG - Intronic
1049132818 8:140863446-140863468 CATTATGTAAACAGGGGTTTAGG - Intronic
1049236692 8:141515673-141515695 AAAGATGTGAGGAGGGGTGGAGG - Intronic
1052859848 9:33430897-33430919 ACTGAGGTAAAGAGTGGTAGTGG + Intergenic
1055009027 9:71543099-71543121 AATGATGTTGAGTGGTGTTGAGG - Intergenic
1056740588 9:89251128-89251150 AGTGATATGAAGAGGGGTGGTGG - Intergenic
1056855959 9:90129863-90129885 AATGAGGGAAAGAGGCTTTGGGG + Intergenic
1060719245 9:125963858-125963880 AATGATTTAAAAAGTGATTGAGG + Intronic
1186999819 X:15164887-15164909 ACTGATGTAAAGAAGGATGGTGG + Intergenic
1192569108 X:72188087-72188109 AATCATGTGAAGTGGGGTTCTGG + Intronic
1194353050 X:92845040-92845062 AATGTTCTAATGAGGGGTCGAGG - Intergenic
1194607312 X:95996898-95996920 ATTGAGGTAAAGAGGTCTTGTGG + Intergenic
1195361523 X:104086926-104086948 AGTGACCTAAAGAGGGGATGTGG - Intergenic
1196800170 X:119535732-119535754 AATGGTGTTACCAGGGGTTGTGG + Intergenic
1197998073 X:132401950-132401972 AATGATGTAAAAAGGTGGAGAGG + Intronic
1198107343 X:133474262-133474284 AATGATGGGAAGAGGGAATGAGG + Intergenic
1198213762 X:134538035-134538057 AAGTATGCCAAGAGGGGTTGAGG - Intergenic
1198222114 X:134612248-134612270 AGTGATGGGAAGAGAGGTTGAGG - Intronic
1198966084 X:142229764-142229786 AATGGGTTATAGAGGGGTTGTGG - Intergenic
1200661405 Y:5962127-5962149 AATGTTCTAATGAGGGGTCGAGG - Intergenic