ID: 1181382442

View in Genome Browser
Species Human (GRCh38)
Location 22:22517161-22517183
Sequence CTTTGTAAGGCCAAGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154866
Summary {0: 1, 1: 41, 2: 1762, 3: 28536, 4: 124526}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181382436_1181382442 -8 Left 1181382436 22:22517146-22517168 CCTGTAATCCCAACACTTTGTAA 0: 5
1: 1345
2: 37232
3: 340340
4: 254089
Right 1181382442 22:22517161-22517183 CTTTGTAAGGCCAAGGCGGAAGG 0: 1
1: 41
2: 1762
3: 28536
4: 124526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181382442 Original CRISPR CTTTGTAAGGCCAAGGCGGA AGG Intronic
Too many off-targets to display for this crispr