ID: 1181390964

View in Genome Browser
Species Human (GRCh38)
Location 22:22580364-22580386
Sequence CAGGCTCTCTCTCGCTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181390959_1181390964 -2 Left 1181390959 22:22580343-22580365 CCAAAACCTGCCCTGGTCTCTCA No data
Right 1181390964 22:22580364-22580386 CAGGCTCTCTCTCGCTATGAAGG No data
1181390957_1181390964 19 Left 1181390957 22:22580322-22580344 CCAAGTTCATGCGTAATGAGACC No data
Right 1181390964 22:22580364-22580386 CAGGCTCTCTCTCGCTATGAAGG No data
1181390956_1181390964 29 Left 1181390956 22:22580312-22580334 CCACAGTGGTCCAAGTTCATGCG No data
Right 1181390964 22:22580364-22580386 CAGGCTCTCTCTCGCTATGAAGG No data
1181390961_1181390964 -8 Left 1181390961 22:22580349-22580371 CCTGCCCTGGTCTCTCAGGCTCT No data
Right 1181390964 22:22580364-22580386 CAGGCTCTCTCTCGCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181390964 Original CRISPR CAGGCTCTCTCTCGCTATGA AGG Intergenic
No off target data available for this crispr