ID: 1181393465

View in Genome Browser
Species Human (GRCh38)
Location 22:22600743-22600765
Sequence TACCCTTCCTTCAGTGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181393460_1181393465 4 Left 1181393460 22:22600716-22600738 CCAGCCAGGCTGTAAGTGAGACC No data
Right 1181393465 22:22600743-22600765 TACCCTTCCTTCAGTGCATGGGG No data
1181393458_1181393465 14 Left 1181393458 22:22600706-22600728 CCATGGGCTCCCAGCCAGGCTGT No data
Right 1181393465 22:22600743-22600765 TACCCTTCCTTCAGTGCATGGGG No data
1181393459_1181393465 5 Left 1181393459 22:22600715-22600737 CCCAGCCAGGCTGTAAGTGAGAC No data
Right 1181393465 22:22600743-22600765 TACCCTTCCTTCAGTGCATGGGG No data
1181393461_1181393465 0 Left 1181393461 22:22600720-22600742 CCAGGCTGTAAGTGAGACCAGAA No data
Right 1181393465 22:22600743-22600765 TACCCTTCCTTCAGTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181393465 Original CRISPR TACCCTTCCTTCAGTGCATG GGG Intergenic
No off target data available for this crispr