ID: 1181394037

View in Genome Browser
Species Human (GRCh38)
Location 22:22605296-22605318
Sequence GTCTCATATCTGGGTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394037_1181394052 25 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394037_1181394043 1 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394043 22:22605320-22605342 TTGAGGCTGCCCTTCCCTCCAGG No data
1181394037_1181394044 9 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394044 22:22605328-22605350 GCCCTTCCCTCCAGGTCTCCAGG No data
1181394037_1181394047 13 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG No data
1181394037_1181394051 24 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394051 22:22605343-22605365 TCTCCAGGTAGGCTATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394037 Original CRISPR GTCTCATATCTGGGTGAACA GGG (reversed) Intergenic
No off target data available for this crispr