ID: 1181394038

View in Genome Browser
Species Human (GRCh38)
Location 22:22605297-22605319
Sequence GGTCTCATATCTGGGTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394038_1181394052 24 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394038_1181394044 8 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394044 22:22605328-22605350 GCCCTTCCCTCCAGGTCTCCAGG No data
1181394038_1181394043 0 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394043 22:22605320-22605342 TTGAGGCTGCCCTTCCCTCCAGG No data
1181394038_1181394051 23 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394051 22:22605343-22605365 TCTCCAGGTAGGCTATGAAAAGG No data
1181394038_1181394047 12 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394038 Original CRISPR GGTCTCATATCTGGGTGAAC AGG (reversed) Intergenic