ID: 1181394041

View in Genome Browser
Species Human (GRCh38)
Location 22:22605306-22605328
Sequence CAGCCTCAAGGTCTCATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394041_1181394044 -1 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394044 22:22605328-22605350 GCCCTTCCCTCCAGGTCTCCAGG No data
1181394041_1181394043 -9 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394043 22:22605320-22605342 TTGAGGCTGCCCTTCCCTCCAGG No data
1181394041_1181394051 14 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394051 22:22605343-22605365 TCTCCAGGTAGGCTATGAAAAGG No data
1181394041_1181394054 24 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394041_1181394052 15 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394041_1181394047 3 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394041 Original CRISPR CAGCCTCAAGGTCTCATATC TGG (reversed) Intergenic