ID: 1181394042

View in Genome Browser
Species Human (GRCh38)
Location 22:22605318-22605340
Sequence TGGAGGGAAGGGCAGCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394042_1181394052 3 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394042_1181394054 12 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394042_1181394051 2 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394051 22:22605343-22605365 TCTCCAGGTAGGCTATGAAAAGG No data
1181394042_1181394047 -9 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394042 Original CRISPR TGGAGGGAAGGGCAGCCTCA AGG (reversed) Intergenic
No off target data available for this crispr