ID: 1181394045

View in Genome Browser
Species Human (GRCh38)
Location 22:22605329-22605351
Sequence ACCTGGAGACCTGGAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394045_1181394054 1 Left 1181394045 22:22605329-22605351 CCCTTCCCTCCAGGTCTCCAGGT No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394045_1181394051 -9 Left 1181394045 22:22605329-22605351 CCCTTCCCTCCAGGTCTCCAGGT No data
Right 1181394051 22:22605343-22605365 TCTCCAGGTAGGCTATGAAAAGG No data
1181394045_1181394052 -8 Left 1181394045 22:22605329-22605351 CCCTTCCCTCCAGGTCTCCAGGT No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394045 Original CRISPR ACCTGGAGACCTGGAGGGAA GGG (reversed) Intergenic