ID: 1181394052

View in Genome Browser
Species Human (GRCh38)
Location 22:22605344-22605366
Sequence CTCCAGGTAGGCTATGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394040_1181394052 16 Left 1181394040 22:22605305-22605327 CCCAGATATGAGACCTTGAGGCT No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394038_1181394052 24 Left 1181394038 22:22605297-22605319 CCTGTTCACCCAGATATGAGACC No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394037_1181394052 25 Left 1181394037 22:22605296-22605318 CCCTGTTCACCCAGATATGAGAC No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394046_1181394052 -9 Left 1181394046 22:22605330-22605352 CCTTCCCTCCAGGTCTCCAGGTA No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394042_1181394052 3 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394041_1181394052 15 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data
1181394045_1181394052 -8 Left 1181394045 22:22605329-22605351 CCCTTCCCTCCAGGTCTCCAGGT No data
Right 1181394052 22:22605344-22605366 CTCCAGGTAGGCTATGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394052 Original CRISPR CTCCAGGTAGGCTATGAAAA GGG Intergenic
No off target data available for this crispr