ID: 1181394054

View in Genome Browser
Species Human (GRCh38)
Location 22:22605353-22605375
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394042_1181394054 12 Left 1181394042 22:22605318-22605340 CCTTGAGGCTGCCCTTCCCTCCA No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394045_1181394054 1 Left 1181394045 22:22605329-22605351 CCCTTCCCTCCAGGTCTCCAGGT No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394046_1181394054 0 Left 1181394046 22:22605330-22605352 CCTTCCCTCCAGGTCTCCAGGTA No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394048_1181394054 -4 Left 1181394048 22:22605334-22605356 CCCTCCAGGTCTCCAGGTAGGCT No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394040_1181394054 25 Left 1181394040 22:22605305-22605327 CCCAGATATGAGACCTTGAGGCT No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394041_1181394054 24 Left 1181394041 22:22605306-22605328 CCAGATATGAGACCTTGAGGCTG No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394049_1181394054 -5 Left 1181394049 22:22605335-22605357 CCTCCAGGTCTCCAGGTAGGCTA No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data
1181394050_1181394054 -8 Left 1181394050 22:22605338-22605360 CCAGGTCTCCAGGTAGGCTATGA No data
Right 1181394054 22:22605353-22605375 GGCTATGAAAAGGGTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394054 Original CRISPR GGCTATGAAAAGGGTGAATC AGG Intergenic
No off target data available for this crispr