ID: 1181394973

View in Genome Browser
Species Human (GRCh38)
Location 22:22614806-22614828
Sequence AGGCATGGGCAGGATCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181394973_1181394986 25 Left 1181394973 22:22614806-22614828 CCCCTCAGATCCTGCCCATGCCT No data
Right 1181394986 22:22614854-22614876 CCTGTGGACACTTCATCCTGAGG No data
1181394973_1181394982 9 Left 1181394973 22:22614806-22614828 CCCCTCAGATCCTGCCCATGCCT No data
Right 1181394982 22:22614838-22614860 CCCCATTTCTTTGAGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181394973 Original CRISPR AGGCATGGGCAGGATCTGAG GGG (reversed) Intergenic
No off target data available for this crispr