ID: 1181398518

View in Genome Browser
Species Human (GRCh38)
Location 22:22637476-22637498
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 10, 1: 0, 2: 6, 3: 100, 4: 772}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181398510_1181398518 14 Left 1181398510 22:22637439-22637461 CCAGGCATTCTTTGTAAGCCCTC No data
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772
1181398512_1181398518 -4 Left 1181398512 22:22637457-22637479 CCCTCCTGACCACCTGGCTCAAA 0: 9
1: 1
2: 3
3: 30
4: 276
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772
1181398509_1181398518 15 Left 1181398509 22:22637438-22637460 CCCAGGCATTCTTTGTAAGCCCT No data
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772
1181398513_1181398518 -5 Left 1181398513 22:22637458-22637480 CCTCCTGACCACCTGGCTCAAAG 0: 9
1: 1
2: 3
3: 21
4: 190
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772
1181398514_1181398518 -8 Left 1181398514 22:22637461-22637483 CCTGACCACCTGGCTCAAAGAAA 0: 9
1: 0
2: 3
3: 13
4: 218
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772
1181398508_1181398518 27 Left 1181398508 22:22637426-22637448 CCTGCGGGGGAGCCCAGGCATTC No data
Right 1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG 0: 10
1: 0
2: 6
3: 100
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181398518 Original CRISPR CAAAGAAAACAGAAGCATGG AGG Intergenic
900803413 1:4751686-4751708 CAAAGAGCACAGAGGCCTGGTGG + Intronic
901264433 1:7899299-7899321 GAAAGAAAACAGAGGCCTGAGGG + Intergenic
901459197 1:9381649-9381671 CAAAAAAAAAAAAAGCATGTTGG + Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901803519 1:11723327-11723349 CAAACAAAACAGAAGCTTTGTGG - Exonic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902577246 1:17386177-17386199 CCCATTAAACAGAAGCATGGGGG - Intronic
902615755 1:17622776-17622798 CAATTAACACAGAAGCATGGGGG + Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905330890 1:37196204-37196226 AGAAGAAAAGAGTAGCATGGTGG + Intergenic
905606854 1:39308639-39308661 AAAAGAAAACTGAAGTATGAAGG - Intronic
906054592 1:42905360-42905382 CAAAAAAAATCTAAGCATGGTGG - Intergenic
906311276 1:44756344-44756366 CAAAGAAAACACAAGAAGCGAGG - Intronic
906920442 1:50058764-50058786 AAAAAAAAATACAAGCATGGTGG - Intronic
906970085 1:50503649-50503671 CAAAAAAAAAAGTAACATGGTGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907777907 1:57536820-57536842 CCATGGGAACAGAAGCATGGAGG - Intronic
907778749 1:57544715-57544737 CAATGAGAATAGCAGCATGGGGG - Intronic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
909973402 1:82018182-82018204 CAAAGAGAAAAGAAGGAAGGTGG - Intergenic
910129735 1:83889256-83889278 TCAAGAGAACAGCAGCATGGGGG + Intronic
910175878 1:84429766-84429788 CAAAGAGAACTGATGCATGAAGG - Intergenic
910313615 1:85856977-85856999 GGAAGTAAAGAGAAGCATGGAGG + Intronic
910527813 1:88201251-88201273 CATAGAAAACTGAAGTAGGGAGG + Intergenic
911151972 1:94605009-94605031 TAAAGAGAACAGAAGCATTTGGG + Intergenic
911289067 1:96033644-96033666 AAAAGTAAATAGATGCATGGAGG - Intergenic
911317644 1:96374867-96374889 AAAAGAGATCAGAAGCATGAGGG - Intergenic
912179591 1:107203067-107203089 GAAGAAAAACAGAAGAATGGAGG - Intronic
912243973 1:107941590-107941612 CAAACAAAACAGAAGTACTGAGG - Intronic
912308709 1:108597372-108597394 CAAAGAGCACAAAAGCATGCTGG - Intronic
912328105 1:108788086-108788108 AAAAGAAAACAGAAACAGGCTGG - Intronic
912504941 1:110150114-110150136 GAAAGGGAACAGAAGCACGGAGG + Intergenic
912616805 1:111110167-111110189 CAAAGGAAGGTGAAGCATGGAGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913591623 1:120334191-120334213 CTAAGCAAACAGAAGCATGCAGG + Intergenic
913651738 1:120920958-120920980 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914169368 1:145208107-145208129 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914457305 1:147847890-147847912 CAAAGAAAGTGGTAGCATGGTGG - Intergenic
914524485 1:148452071-148452093 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914599183 1:149183759-149183781 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914641917 1:149615069-149615091 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914815917 1:151062351-151062373 AAAAAAAAATAGAATCATGGGGG - Intronic
914905441 1:151739909-151739931 CAAGGAAATCAGAATCATGCAGG - Intergenic
915062373 1:153196917-153196939 AAAAGGAAACAGAAGCCTGGTGG + Intergenic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915309005 1:154997992-154998014 CCATGCAAACAAAAGCATGGAGG + Intergenic
915446123 1:155975984-155976006 AAAAGAAAAAGGAAGCATGGAGG + Intronic
916591078 1:166191099-166191121 AGAAAAAAAGAGAAGCATGGTGG + Intergenic
916965703 1:169940223-169940245 TTAAGAAAACTGAAGCATGTAGG - Intronic
917575262 1:176314590-176314612 CAAAGATAAGCCAAGCATGGTGG - Intergenic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917860857 1:179141940-179141962 AAAAGAAAACAAAAGCCTGTGGG + Intronic
918175662 1:182042540-182042562 AAAATAAAAAAGAAACATGGAGG - Intergenic
918180561 1:182083278-182083300 CAAAAAAAATAGACACATGGTGG + Intergenic
918694316 1:187524320-187524342 AAAATAAAACAGAAGCAGGGTGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919524642 1:198632809-198632831 AAAAGAAAACATAGGCATTGAGG - Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
919846702 1:201647478-201647500 AAAAGAAAACAGAACCAGAGGGG + Intronic
919905800 1:202077550-202077572 CTATGAAAACAGAAGCACAGAGG - Intergenic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
920770518 1:208880704-208880726 GAAAGAAAACATAAGTAGGGAGG + Intergenic
921399630 1:214707268-214707290 TAACGAGAACAGCAGCATGGTGG - Intergenic
921679670 1:218015598-218015620 GAAAAAAAACAAAAGCATGAAGG - Intergenic
922592272 1:226786258-226786280 AAAAGAGAACAAAAGCATGAAGG - Intergenic
922789479 1:228303278-228303300 GGAAGAAAACAGAAGCAGGAAGG - Intronic
922919841 1:229293227-229293249 CAAAAAAACCAAAAGGATGGGGG - Intronic
923028002 1:230221958-230221980 AAAAGAAGACAGAAGTAAGGAGG - Intronic
923303456 1:232665011-232665033 AAAGGAAACCAAAAGCATGGGGG - Intergenic
923660643 1:235954446-235954468 AAAAAAAAACAGAGGCATAGTGG + Intergenic
923902658 1:238344762-238344784 CAAAGAAAATACAAGCAAAGAGG - Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924264164 1:242264336-242264358 CATAGAAAACATGTGCATGGTGG + Intronic
924716726 1:246582348-246582370 AAAAAAAAAAAAAAGCATGGAGG - Intronic
1062794170 10:330639-330661 AAAAAAAAAAACAAGCATGGTGG - Intronic
1062951856 10:1509500-1509522 CAAAGAAAACAGTAGCAGCTCGG - Intronic
1063056864 10:2514635-2514657 CAAAGAAAACAAAAGCTGGAAGG + Intergenic
1063553484 10:7055608-7055630 CAAAGAAAAAACAGGCAAGGGGG + Intergenic
1063673466 10:8118479-8118501 CAAAAACAAAAAAAGCATGGAGG + Intergenic
1064223176 10:13459193-13459215 CTCACAAAATAGAAGCATGGTGG + Intronic
1064434427 10:15298893-15298915 CCAATGAAACAGAAGCATGTTGG - Intronic
1064555531 10:16543500-16543522 TGAAGAAAACAAAAGCAGGGAGG + Intergenic
1064620891 10:17216288-17216310 AAAAGAAAACAGAAGCATAATGG + Intergenic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065675019 10:28164955-28164977 AAATCAAAACAGAAACATGGGGG + Intronic
1066071705 10:31822193-31822215 CAAAGAAAACAGAATTATTGTGG + Intronic
1066289114 10:33997888-33997910 CAAACAAAAAAGAAACATGGAGG + Intergenic
1066354622 10:34670351-34670373 GTAAGAAATCAGAAGCATAGTGG - Intronic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066508828 10:36072826-36072848 AAAATAAAACATAAGCAGGGAGG + Intergenic
1066513182 10:36124449-36124471 CAAAGCAAACAGAGGCATAAAGG - Intergenic
1066600426 10:37100051-37100073 CAAAGCAAACAGAAACAAAGTGG + Intergenic
1066686840 10:37989697-37989719 GAAAGCAAAGAGAAGCATGATGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068625379 10:59240663-59240685 CAAAGACAACAGAAATATGGAGG - Intronic
1068631905 10:59306882-59306904 CAAACAAAAAAGAATAATGGTGG + Intronic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070566814 10:77609975-77609997 CGATGAAAACAGAAACAAGGCGG + Intronic
1070762119 10:79030351-79030373 CAAAGAGAAGAAAAGGATGGAGG - Intergenic
1070950433 10:80426817-80426839 CCAAGAAAACAGAACCCTGCTGG - Intronic
1072504873 10:96055790-96055812 TAAAGAAAAAAGGGGCATGGGGG - Intronic
1072709169 10:97704652-97704674 CAATGTGACCAGAAGCATGGTGG + Intergenic
1073978070 10:109122860-109122882 CAGATAGAGCAGAAGCATGGTGG + Intergenic
1074233151 10:111557769-111557791 GAAATAAAACAGCAGCATGGAGG - Intergenic
1074264823 10:111891179-111891201 AAAAAAAAACAGAATCATTGAGG + Intergenic
1074393438 10:113077152-113077174 GAAAGAAAACAGAAGCTCTGTGG + Intronic
1074561450 10:114538982-114539004 AACTGAAAACAGAAGCCTGGAGG - Intronic
1074839977 10:117341336-117341358 CAAAGAAAAGAAAAGCCTAGAGG + Intronic
1075109511 10:119566755-119566777 CAAAAAAAACCCAGGCATGGTGG - Intergenic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1076353221 10:129832771-129832793 CACAGGATACAGAAGCATGTGGG - Intergenic
1076388179 10:130074386-130074408 AGAAGAAAACACAATCATGGAGG - Intergenic
1076498496 10:130915455-130915477 CAAAGAAAACAAAATTATTGGGG + Intergenic
1077680248 11:4233329-4233351 CAATGTCAACAGGAGCATGGAGG + Intergenic
1077681236 11:4242577-4242599 CAATGTCAACAGGAGCATGGAGG - Intergenic
1077684527 11:4278748-4278770 CAATGTCAACAGGAGCATGGAGG + Intergenic
1077685514 11:4288020-4288042 CAATGTCAACAGGAGCATGGAGG - Intergenic
1077689660 11:4329906-4329928 CAATGTCAACAGGAGCATGGAGG + Intergenic
1077690667 11:4339181-4339203 CAATGTCAACAGGAGCATGGAGG - Intergenic
1077980711 11:7297892-7297914 CAAAGAAATTAGAACCATAGTGG - Intronic
1078497603 11:11834914-11834936 ATAAGAAAACTGAAGCTTGGTGG + Intergenic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079508137 11:21178221-21178243 CCAAGAAAACAGAAACATTGTGG - Intronic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080327476 11:31094145-31094167 CAATGGAAACAGAGGCATGAAGG + Intronic
1080891020 11:36409367-36409389 CAACAAGAACAGAAGCAGGGTGG - Intronic
1081047257 11:38291616-38291638 TCATGAAAACAGCAGCATGGGGG + Intergenic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081363215 11:42205210-42205232 GAAAGAGAGCAGAAGCAGGGTGG + Intergenic
1084682035 11:70672042-70672064 AAAAGAAAAGAAAAGTATGGTGG - Intronic
1084969616 11:72763898-72763920 AATAGAAAACTGAAGCTTGGGGG + Intronic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085791559 11:79501396-79501418 ATAAGCAAACAGAAGCAGGGCGG - Intergenic
1086052670 11:82612455-82612477 CAAGGAAAAGAAAAGCAAGGGGG - Intergenic
1086156431 11:83671960-83671982 CAAAGAAAAAAGAGACATAGGGG - Intronic
1086532445 11:87801482-87801504 GAAAGGAAACTGAAGCAGGGTGG - Intergenic
1086753078 11:90523858-90523880 CAAAGAGAATAGAAGGATGATGG - Intergenic
1086891439 11:92262882-92262904 AAAAGAATACAGAATCATAGAGG + Intergenic
1086920743 11:92583574-92583596 CAAAGAGAACAGCAGAATAGGGG - Intronic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1089288633 11:117423776-117423798 CAAAAAATACAGATGCCTGGGGG + Intergenic
1089702258 11:120252539-120252561 CACAGAAAGCAGAAACAAGGTGG - Intronic
1090301678 11:125646909-125646931 ACAAGAAAACAAAAGAATGGGGG - Intronic
1090703242 11:129314820-129314842 CAAAGAAAGCAAAAGAAAGGAGG - Intergenic
1091056943 11:132428435-132428457 CAAACAAAATATAAGCATAGGGG + Intronic
1091076423 11:132622306-132622328 CAAAGACAACTGAAGAAAGGGGG + Intronic
1091107041 11:132932326-132932348 CAATAAAAACAGGGGCATGGAGG + Intronic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093787380 12:23208176-23208198 CAAAGGGAACAGCAGCATGGTGG - Intergenic
1093910955 12:24746965-24746987 CAAAGAAAGCAGGCACATGGAGG + Intergenic
1094162273 12:27404206-27404228 CAAAAAAAAAAAATGCATGGTGG - Intronic
1094617121 12:32046084-32046106 CCAAGAACACAAAAGAATGGGGG + Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1094790427 12:33906930-33906952 CAAAGAGAAAAGAACAATGGGGG + Intergenic
1094846356 12:34363098-34363120 CAAGGAAAACAGAAACACCGAGG - Intergenic
1094846675 12:34364401-34364423 GAAGGAAAACAGAAACAGGGAGG - Intergenic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1095968700 12:47886434-47886456 CAAAGAAAATGGATACATGGTGG - Intronic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097888079 12:64750028-64750050 CAACAAAAACAGAGGCATGGTGG - Intronic
1097925648 12:65122744-65122766 CAAAGAAAACGGAAGCAAAAGGG + Intergenic
1098557965 12:71840197-71840219 CAAAGAAGACAGAGGCAAGTCGG - Intronic
1098605276 12:72382025-72382047 GAAACAAAACAGGAGCAAGGGGG + Intronic
1098632138 12:72737177-72737199 AAAAGAAAACTGAAGCCTGGAGG - Intergenic
1098847255 12:75552849-75552871 CAATGAACTCAGAAGCATGGTGG + Intergenic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099151826 12:79123944-79123966 ATAACAAAACAGAAGCAGGGTGG - Intronic
1099672771 12:85716860-85716882 GAAAGATAACTGAATCATGGGGG - Intergenic
1100368617 12:93944196-93944218 CAAAGGATAGAGAAGCATGTAGG - Intergenic
1100555516 12:95689416-95689438 CAAAGAAACAAGAAAGATGGAGG - Intronic
1100814410 12:98372417-98372439 ACAAGAAAACTGAAGCAGGGAGG + Intergenic
1101137894 12:101764327-101764349 AAAAGAGAACAGTAGAATGGAGG - Exonic
1101250434 12:102928985-102929007 CCATGAGAACAGCAGCATGGGGG - Intronic
1101469786 12:104985878-104985900 CAAAGAAGAAAGTAGAATGGTGG + Intergenic
1101610770 12:106289585-106289607 ATATGAAAACAGAAGCATGGTGG + Intronic
1103229747 12:119319382-119319404 CAAAGAAAAGAGATGCATTTGGG + Intergenic
1104180174 12:126372211-126372233 CAAAGATAACTGAATCATGGGGG - Intergenic
1104261715 12:127189724-127189746 AAAATATAACAGAAGCATTGTGG - Intergenic
1104527479 12:129537779-129537801 CCAAGAATGCGGAAGCATGGGGG + Intronic
1105051027 12:133051072-133051094 CAAACAAAACACAGGCATGGTGG - Intronic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1107146557 13:37066841-37066863 CAAAGAAAAAAAAAGCATTTGGG - Intergenic
1107315313 13:39125190-39125212 ACAAGAGAACAGATGCATGGTGG + Intergenic
1107465682 13:40647736-40647758 CAAAGAACCTAGAAGGATGGGGG + Intronic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108309929 13:49178404-49178426 CACTGAAGACAGAAGCATCGAGG + Intronic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1110681730 13:78321842-78321864 GAAGAAAAACAGAAGCCTGGGGG + Intergenic
1110688633 13:78405049-78405071 CAAAGGAAACAGAAGCTGAGTGG + Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1111262614 13:85761262-85761284 AAAAGAAAAATCAAGCATGGAGG - Intergenic
1112295068 13:98179314-98179336 CAGAGATAACTGAATCATGGGGG - Intronic
1112821631 13:103344775-103344797 CAAAGAAAACAGAAACAATTTGG - Intergenic
1112861409 13:103832631-103832653 TCATGAAAACAGCAGCATGGGGG - Intergenic
1112884311 13:104149578-104149600 CAAAGAAAACAAAGAAATGGAGG + Intergenic
1112913014 13:104512096-104512118 AAAAGAGAACAGAATCATGTAGG + Intergenic
1114390586 14:22303821-22303843 AAAAAAAAACAAAAGAATGGGGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115650353 14:35398668-35398690 AAAAGAAAAGAAAAGCAGGGAGG + Intergenic
1115881507 14:37924374-37924396 AAAAAAAAAGAGAAGCATGAAGG - Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117872272 14:60213631-60213653 GAAAGAAAGAAAAAGCATGGAGG - Intergenic
1119362020 14:74058779-74058801 CAAAGAAACAAAAAGCATAGAGG + Exonic
1119540828 14:75437179-75437201 AAAAAAAAAAAAAAGCATGGAGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120183613 14:81369792-81369814 CAATGAAAAGTGAAGCAGGGAGG + Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121207008 14:92178042-92178064 CAACGACCAGAGAAGCATGGAGG - Intergenic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1122366958 14:101200032-101200054 CAAAGAAAAAAAAAAGATGGCGG + Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1123045968 14:105514959-105514981 CCAAGAGAAGAGTAGCATGGGGG - Intergenic
1123435157 15:20248952-20248974 CAAAGAAAAAAAAAGCTTGAGGG - Intergenic
1123983117 15:25621667-25621689 CAAAAAAACCAGCAGCAGGGCGG - Intergenic
1124095179 15:26642532-26642554 CAAAGAAATGAGAAACATGAAGG + Intronic
1124390582 15:29252891-29252913 CAAAGAAAACAGCATAATGAAGG + Intronic
1124796471 15:32785858-32785880 CAAAGAAAAGAGACACATTGAGG + Intronic
1125499266 15:40228319-40228341 CAAAGCAAACACTAGCATGGTGG + Intergenic
1126316491 15:47375397-47375419 AAAAGAAAATAGAAAAATGGAGG - Intronic
1127431171 15:58910200-58910222 GAAAGTAAACAGAGGCATAGGGG + Intronic
1127443542 15:59036577-59036599 CAGAGATAACTGAATCATGGGGG - Intronic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1128045811 15:64616804-64616826 AAAAAAAAAAAAAAGCATGGTGG - Intronic
1128160294 15:65419215-65419237 AAAAAAAAAAAAAAGCATGGCGG - Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129374349 15:75118809-75118831 AAAAGAAAACAAAGGCATGTAGG - Intergenic
1129374424 15:75119472-75119494 AAAAGAAAACAAAGGCATGTAGG - Intergenic
1129853007 15:78805552-78805574 GAAAGGAAACACAAGCATGATGG - Intronic
1129940640 15:79494158-79494180 CAATGAGACCAGAGGCATGGAGG + Intergenic
1130249955 15:82293495-82293517 GAAAGGAAACACAAGCATGATGG + Intergenic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131007043 15:88986883-88986905 AAAACAAAACAGAAACAAGGTGG - Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1131978320 15:97969097-97969119 AAAAGAAAACAAAACCAGGGAGG - Intronic
1132238861 15:100242081-100242103 CAAAGAGCACAGGAGCCTGGGGG + Intronic
1132439442 15:101844344-101844366 AAAAGAAAAAAAAAGCATGGTGG + Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1134049773 16:11129425-11129447 GACAGAAAACAGAAGCAAAGAGG - Intronic
1134230514 16:12425565-12425587 AATAGAAAACAGAGGCAGGGTGG + Intronic
1134368001 16:13597085-13597107 AAAAAAAAAAACAAGCATGGTGG + Intergenic
1134391482 16:13824072-13824094 CCATGAGAACAGCAGCATGGGGG - Intergenic
1135031686 16:19043866-19043888 CAAAGAAAACAAAAGCAGGCCGG - Intronic
1135083417 16:19455454-19455476 CAAAAAAACAAGAAGCATGGAGG + Intronic
1136012606 16:27373728-27373750 CAAAGAAAGTAGACTCATGGTGG + Intergenic
1136052187 16:27659677-27659699 CAGAGAAAATAGAGGCATGTAGG + Intronic
1136476592 16:30517461-30517483 CAAAGAAAAAAAAATCAAGGGGG + Intronic
1136849442 16:33602000-33602022 CAAAGAAAAAAAAAGCTTGAGGG + Intergenic
1137380848 16:47998250-47998272 CAAAGAAAAAAAAAGTTTGGAGG + Intergenic
1137549084 16:49424550-49424572 CAAAGGAAAGAAAATCATGGAGG + Intergenic
1137788321 16:51154496-51154518 CAATAAAAACAGAAGCAGAGTGG + Intergenic
1137889659 16:52145790-52145812 CAAAGCAAACTGAAGCAAGAAGG + Intergenic
1138058022 16:53856750-53856772 AAAAAAAAAAACAAGCATGGAGG + Intronic
1138493448 16:57392003-57392025 CAAACAAAAAACAAGCATGGTGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1138755818 16:59483569-59483591 AACAGAAAACAAAAGCATGCAGG - Intergenic
1139445490 16:66995678-66995700 CAAGGAAAACAGATGCATGTGGG + Exonic
1139926723 16:70492356-70492378 CAATGATAAAAGTAGCATGGAGG + Intronic
1140399177 16:74656476-74656498 AAAAGAAAAAAAAAGAATGGTGG - Intronic
1140735200 16:77892071-77892093 CAAAGAAAAGAGATGAATGTGGG + Intronic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1141784692 16:86191257-86191279 CAAAAAAAAGAGAAGCCTGAAGG + Intergenic
1141902163 16:86998034-86998056 AAAAAAAAAAAAAAGCATGGGGG + Intergenic
1203111150 16_KI270728v1_random:1450650-1450672 CAAAGAAAAAAAAAGCTTGAGGG + Intergenic
1143595271 17:7910146-7910168 GAAAGAAAAAGGGAGCATGGAGG - Intronic
1144033872 17:11347684-11347706 CGAAGAAAACAAAAGCAGTGTGG + Intronic
1144514556 17:15908238-15908260 AAAAGAAAACTCAGGCATGGTGG - Intergenic
1144646807 17:16980789-16980811 CAAAGGAATCAAAAGCTTGGGGG - Intergenic
1146499183 17:33349635-33349657 CAAAGAAAACTGAAGCTTCCAGG - Intronic
1147050948 17:37794469-37794491 CAAGGAAAAAAGCAGCCTGGAGG + Intergenic
1147735340 17:42633923-42633945 CCAAAAAAACACACGCATGGTGG - Intergenic
1148269459 17:46252355-46252377 GAAAGAAAATGGAGGCATGGTGG - Intergenic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1148913018 17:50953391-50953413 CAAGGAAAACCCAGGCATGGTGG + Intergenic
1149484951 17:57035340-57035362 CAAAAAATACAGAAAAATGGTGG - Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1149933584 17:60780938-60780960 AAAATAAAACAGAACCATGGTGG - Intronic
1150171039 17:62995094-62995116 CAAAGAAAATGGAAACATGATGG - Intergenic
1150244024 17:63660354-63660376 AAAAGAAAAGCCAAGCATGGGGG - Intronic
1150402532 17:64870813-64870835 GAAAGAAAATAGAAGGAAGGGGG - Intronic
1150465206 17:65386810-65386832 AAAAGAAAAAAGAGGCAGGGAGG - Intergenic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1151234167 17:72706640-72706662 GAAGAAAAACAGAAGCAGGGTGG - Intronic
1151258530 17:72898774-72898796 AAAAGAAAAGAGAACCAGGGTGG - Intronic
1151391964 17:73793397-73793419 AAAAGAAAAAAAAAGCACGGAGG - Intergenic
1152112226 17:78363364-78363386 AAAAAAAAAAAGAAGCTTGGTGG - Intergenic
1152650973 17:81492701-81492723 AAAAGAAAACAAAAGCGGGGAGG + Intergenic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153073465 18:1133416-1133438 CAAGGAAAAGTCAAGCATGGTGG - Intergenic
1153122821 18:1751287-1751309 CAAAGAGAACATTGGCATGGGGG - Intergenic
1153125043 18:1781203-1781225 CAACATAAACAGAAGCATAGAGG - Intergenic
1153234438 18:2972076-2972098 CAAAGAAAAGAAATCCATGGTGG + Intronic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1153997783 18:10456114-10456136 CAAAGAAAACAGCATCCCGGTGG - Intronic
1155132665 18:22953999-22954021 CCACAAGAACAGAAGCATGGGGG + Intronic
1155511088 18:26578030-26578052 AAAAGAAAAGAAAAGCAAGGTGG - Intronic
1155855622 18:30830689-30830711 CAAAGAAAAAAAAAGCGGGGGGG + Intergenic
1156328942 18:36101331-36101353 GAAAGAGAGCAGAAGCAGGGTGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156595386 18:38542551-38542573 AAAGGAAGACAGAAACATGGGGG - Intergenic
1157070564 18:44403046-44403068 AGAAGAAAACAGAAGCAGAGTGG - Intergenic
1157561291 18:48648248-48648270 CAAAGAAAAAGGGAGCATGGGGG + Intronic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158008417 18:52699815-52699837 CAAGGAAAACAAAAGAATTGGGG - Intronic
1158032636 18:52985203-52985225 AAAAGGAAACCCAAGCATGGAGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158369520 18:56784121-56784143 GAAAGAAAACAAAAGGCTGGGGG - Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1159027572 18:63200055-63200077 CAAACAAAACAGGAACATGTTGG - Intronic
1159121643 18:64178041-64178063 AAAATAAAACAGAAGCAAGATGG - Intergenic
1159377947 18:67618453-67618475 TTAAGGGAACAGAAGCATGGGGG - Intergenic
1159850423 18:73520667-73520689 CATAGATAACTGAATCATGGGGG + Intergenic
1159879678 18:73846468-73846490 CAAACAAAAAACAAGCAGGGTGG + Intergenic
1159960435 18:74551394-74551416 AAACAAAAACAGAGGCATGGAGG + Intronic
1160003144 18:75046791-75046813 CATAGAAAACACATGCAAGGAGG - Intronic
1160054369 18:75465272-75465294 AGAAGAGAAAAGAAGCATGGTGG + Intergenic
1160067165 18:75586405-75586427 AAAGGAAGAGAGAAGCATGGAGG - Intergenic
1160259239 18:77275600-77275622 CCAAGAAAGCAGAAGAGTGGGGG + Exonic
1160539603 18:79613368-79613390 CAAACAAAGCAGCAGCATGGAGG + Intergenic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1161652645 19:5494859-5494881 CAAAGAAAATAAAAGCCTAGGGG - Intergenic
1161817260 19:6507070-6507092 AAAAGAAAAAAGAAGCATAGGGG - Intergenic
1162002602 19:7756618-7756640 TAAAGATAACTGAATCATGGGGG + Intergenic
1162207873 19:9069682-9069704 AAAAGAAAAGAGGAGCCTGGTGG - Intergenic
1162450439 19:10751104-10751126 CAGAGAAAAATGAGGCATGGGGG + Intronic
1162864904 19:13538345-13538367 GAAAGAAAGCAGAAGCTGGGAGG + Intronic
1162896212 19:13765993-13766015 CAGAGACAACCGAAGCATTGGGG + Exonic
1162981682 19:14244404-14244426 TAAATAAAATAGAAGCAAGGGGG + Intergenic
1163532772 19:17860273-17860295 AAAGGAAAACAGAAACTTGGCGG - Intronic
1163611422 19:18303823-18303845 AAAAGAAACCAGAAACAGGGCGG - Intergenic
1163780491 19:19244698-19244720 AAAAGAAAAAAGATACATGGTGG - Intronic
1164558185 19:29269476-29269498 AAAAAAAAAAAGAGGCATGGGGG + Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164663417 19:30001100-30001122 AGAAGAAAAAAGAAACATGGAGG - Intronic
1165143285 19:33715522-33715544 CAAGGCAACCAGAAGCATGCTGG - Intronic
1165164698 19:33843773-33843795 AAAAAAAAAAAAAAGCATGGCGG + Intergenic
1165300131 19:34963572-34963594 CACCGAGAACAGAAGCGTGGGGG + Intronic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1167303615 19:48694600-48694622 CAAGGAAAAAAGAAACAGGGTGG - Intergenic
1168340454 19:55620366-55620388 CAATGACATCAGAAGCATGGAGG + Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926443373 2:12914032-12914054 CAAAGAAAAGACAAGCATTTTGG + Intergenic
926582428 2:14645709-14645731 CAAAGGAAACAAAATCATTGTGG - Intronic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926816452 2:16802549-16802571 AAAAGAAAAAAGAAACATGTTGG + Intergenic
928000969 2:27522884-27522906 AAAAAAAAACAGAACCCTGGAGG - Intronic
928235085 2:29532262-29532284 CAAAGAAAATCTAAGAATGGAGG - Intronic
928473370 2:31597197-31597219 CAAAGCAAACAGAAACAAAGTGG + Intergenic
928750536 2:34466199-34466221 TAAGGAAAAGAGTAGCATGGTGG + Intergenic
928838191 2:35573331-35573353 AAAAGAAAGCAAAAGCATGCAGG - Intergenic
928943884 2:36754645-36754667 AAAAGAAATCTGAGGCATGGTGG + Intronic
929148641 2:38728530-38728552 CTAAAAATACAAAAGCATGGTGG + Intronic
929746568 2:44665604-44665626 CAATGAAGACAGGAGCATTGAGG - Intronic
930037049 2:47092786-47092808 AAAAAAAAACAGAACCGTGGAGG - Intronic
930514344 2:52387274-52387296 AAAAAAAAACAGAAGAATAGGGG - Intergenic
930877603 2:56236739-56236761 CAAAGAAAAAAGGACCATGCAGG - Intronic
931039699 2:58283711-58283733 TAATGAGAACAGCAGCATGGGGG - Intergenic
931328954 2:61259384-61259406 CAAAAAAAAAAGAAACATGGAGG - Intronic
931835033 2:66090133-66090155 CAAAGCAAAGAAAAACATGGGGG + Intergenic
931992582 2:67805443-67805465 GAAAGAAAGCAGAAAAATGGGGG + Intergenic
932073660 2:68644206-68644228 CAAAGAATACAGAAGCTTCGGGG - Intronic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932283394 2:70513602-70513624 CAAGGATAACAGTAGCAAGGGGG + Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932883272 2:75523982-75524004 TTAGGAGAACAGAAGCATGGGGG - Intronic
933086188 2:78057470-78057492 CATAGAAAAAAGAACCATGGAGG - Intergenic
933423834 2:82085831-82085853 CAGAGACAACTGAATCATGGGGG - Intergenic
934621091 2:95807544-95807566 CATTAAAAACAGAAGAATGGAGG + Intergenic
934812353 2:97291277-97291299 CATTAAAAACAGAAGAATGGAGG - Intergenic
935185923 2:100732735-100732757 CAAAGAAAGCAGAGGCCTTGTGG - Intergenic
935278382 2:101495911-101495933 AAAAGAAAAGAAAAACATGGCGG - Intergenic
935872208 2:107463425-107463447 GTAAGAAAACAGAAGCAGGCCGG + Intergenic
936869521 2:117118353-117118375 CAAAGAAAACAAATGCTTGAGGG - Intergenic
936943458 2:117909599-117909621 AAAAAAAAAAAGAAACATGGAGG - Intergenic
937380251 2:121370310-121370332 GAAAGAAAATCGAAGAATGGAGG - Intronic
937930604 2:127202120-127202142 CAAAAAAAAAAAAAGCATGTTGG - Intronic
937997715 2:127707800-127707822 CTAAAAACACAAAAGCATGGTGG + Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
940149579 2:150584525-150584547 GAAAGAAATCAGAAGCTTGTAGG + Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941435122 2:165460994-165461016 CAAAAAAAACTTAGGCATGGTGG - Intergenic
941494927 2:166188068-166188090 CCAAGGAGACAGAAGCAGGGAGG + Intergenic
941601953 2:167553687-167553709 CTAAGAAAAATGAACCATGGTGG - Intergenic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942149478 2:173060909-173060931 TGAAGAAAACAGAGGCAAGGGGG + Intergenic
942644053 2:178091745-178091767 CAAATATAAGAGACGCATGGTGG - Intronic
942683662 2:178508441-178508463 AATAGAAAGCAGAAACATGGTGG - Exonic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
942725177 2:178998472-178998494 GAAAAAAAACTGAAGCATGGAGG - Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942962283 2:181845664-181845686 CAAAACAAACAGAAGCATTAAGG - Intergenic
943620377 2:190141598-190141620 TCAAGAAAACAGCAGCATGGGGG + Intronic
943654682 2:190495716-190495738 CAAAGCAAACAGAAACATAAAGG + Intronic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944358909 2:198828181-198828203 AAAACAAAACAGAACCTTGGAGG - Intergenic
944931152 2:204521010-204521032 CATAGAGCACAGAAGCATGGAGG + Intergenic
945077932 2:206059083-206059105 CAAAGAAAACAGAACCAGCCGGG + Intronic
945093809 2:206200426-206200448 CAAAGAAAGAAAAAGAATGGTGG + Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945877074 2:215289166-215289188 CAAAAAAAACAGAAATAGGGTGG + Intergenic
946070910 2:217033595-217033617 AAAAGAAAACATAAGCTGGGGGG + Intergenic
946157436 2:217816252-217816274 CAAAGAAAACACAAAAAGGGAGG + Intronic
946472402 2:219974434-219974456 CCATGAGAACAGCAGCATGGGGG + Intergenic
946533993 2:220607109-220607131 TAATGAGAACAGCAGCATGGGGG + Intergenic
947460921 2:230304632-230304654 CAAAGCAAACAAAAGCATAAAGG + Intronic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
948663385 2:239520234-239520256 GAAAGAGAACGGAGGCATGGAGG + Intergenic
948742045 2:240054554-240054576 TAATGAAAGCAGAAGCCTGGAGG - Intergenic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1168819779 20:765113-765135 CAAAGAACCTAGAAGGATGGAGG + Intronic
1168995887 20:2132967-2132989 CAAACAAAATAGCAGGATGGGGG - Intronic
1169165158 20:3416280-3416302 ATAAGAAAACAGAAGCCAGGCGG - Intergenic
1169644811 20:7798294-7798316 CTAAGAAATAAGATGCATGGTGG - Intergenic
1170010136 20:11713928-11713950 CAAAAAAAAAAGAAGCATATGGG - Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170610089 20:17905948-17905970 CAAAGAAGTAAGAAGCTTGGTGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172480574 20:35269041-35269063 GAAAGAAAACTGAGGCCTGGAGG + Intronic
1172681687 20:36720750-36720772 AAAAGAAAAAAGAAGTATGAGGG - Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173393155 20:42653134-42653156 CCATGAGAACAGCAGCATGGGGG - Intronic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174557972 20:51409805-51409827 CAAAGAGAACAGATGAATGTGGG + Intronic
1174626252 20:51916876-51916898 TAAAGAAAAAAAAAGCAGGGTGG + Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1176155526 20:63618186-63618208 CAAAGGAAAAAGGAGAATGGAGG + Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1177503120 21:21984718-21984740 CAAAGCAAACACAAGCAAAGTGG + Intergenic
1177763228 21:25426390-25426412 CAAATAAAACAGATACCTGGAGG + Intergenic
1178383502 21:32131156-32131178 CAAGTAAAACAGGAGTATGGTGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1179325777 21:40342862-40342884 CAAGCAAAACTGAGGCATGGTGG - Intronic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181621691 22:24095599-24095621 CAAAGAGAACAGCAGCACTGTGG + Intronic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1183126261 22:35784610-35784632 CAATGAAGACAGATGCTTGGTGG + Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949442841 3:4102041-4102063 CCAAGAGAACAGCACCATGGGGG + Intronic
949460326 3:4284756-4284778 CAAAATATAAAGAAGCATGGGGG + Intronic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
950671605 3:14530020-14530042 CAAAGATTTCAGAACCATGGAGG + Intronic
950838799 3:15947051-15947073 TCATGAAAACAGCAGCATGGGGG - Intergenic
951213475 3:20001292-20001314 TAAACAAAACAGAAGCAGTGAGG - Exonic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951552512 3:23888231-23888253 GAAAGAAAACTGAGGCCTGGAGG - Intronic
951690645 3:25392157-25392179 CAAAGCAAACAAAAGCAAAGTGG - Intronic
952187663 3:30988144-30988166 CATAGAAAACAAAAGCATTTGGG - Intergenic
952261255 3:31742715-31742737 CAAATCAACCAGAAGCATGGAGG + Intronic
952760363 3:36908215-36908237 TAAAGAAAACAGAAACAGGGTGG + Intronic
953060656 3:39426347-39426369 AAAAAAAAAAAAAAGCATGGAGG + Intergenic
953497529 3:43401137-43401159 CAAACAAAACAAAAGGCTGGGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954308148 3:49742562-49742584 AAAAAAAAATAGAAGCATAGTGG + Intronic
954424400 3:50435771-50435793 AAAAGAAAAGAGAAGCCGGGAGG - Intronic
954437108 3:50502275-50502297 GACAGATAACAGAAGCAAGGTGG + Intronic
954938562 3:54349619-54349641 AAAAGAAAAAAGAAGCTTGTGGG - Intronic
955374654 3:58385092-58385114 CAAAGACAACAACAGCATGTGGG - Intronic
955704590 3:61715161-61715183 CAAAGAAAAAAAAAGCAAGCAGG - Intronic
955736625 3:62045588-62045610 TACAGAAAACAGCAGCATTGAGG - Intronic
956655164 3:71542862-71542884 CAGATAACACAAAAGCATGGAGG + Intronic
956835679 3:73094479-73094501 AAAAGAAAAGAAAGGCATGGTGG - Intergenic
957115458 3:76018893-76018915 CAGAGAAAACCGAACCATGTGGG - Intronic
957115503 3:76019343-76019365 CAGAGAAAACCGAACCATGTGGG - Intronic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
957115521 3:76019523-76019545 CAGAGAAAACTGAACCATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957511408 3:81192701-81192723 CAAAGAAAACAAAAGAATTATGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958842199 3:99220213-99220235 CAAAGAAAAAACAAGCAGGAAGG + Intergenic
959562150 3:107795222-107795244 CAAAGCAGACAAAAGCTTGGTGG - Intronic
959576424 3:107939222-107939244 TCAAGAAAACAGAAGAATAGGGG - Intergenic
960033038 3:113073926-113073948 AAAAGAAAACCTAAGCAAGGAGG - Intergenic
960182306 3:114595045-114595067 AAATGAAAAAAGAAGCATGAAGG - Intronic
960853307 3:122077957-122077979 CAAGGAACACAGAAGCAAGGTGG - Intronic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961314687 3:126026486-126026508 GACAGAAATCAGAAGCATGAAGG + Intronic
962328693 3:134458050-134458072 CAAAGATGACAGAAGCATTACGG + Intergenic
962539074 3:136360107-136360129 CAACAAAAACAGAACCCTGGAGG + Intronic
962646281 3:137444262-137444284 TCAAGAGAACAGTAGCATGGGGG + Intergenic
962712524 3:138100022-138100044 CAAAAAAAAAAAAAGGATGGGGG - Intronic
962774476 3:138646203-138646225 CAAACAAAACAAAAGCATGCAGG - Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963918713 3:150885447-150885469 AAAAGAAAAGAAAAGCATGTTGG + Intronic
963929867 3:150992292-150992314 CAAAGGAAACCAAAGCAGGGAGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964599569 3:158482573-158482595 CAAATAAAACAAAGGGATGGAGG - Intronic
964637122 3:158870318-158870340 CAAAGAAGACGGAAGCTTGGGGG - Intergenic
965072817 3:163937692-163937714 TCATGAAAACAGCAGCATGGGGG + Intergenic
965134322 3:164741941-164741963 CTCAGAAAGCAGAAGCCTGGTGG + Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
965988954 3:174792066-174792088 CAAACAAAAAACAGGCATGGTGG + Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
967040377 3:185686516-185686538 CAAACAATTTAGAAGCATGGTGG + Intronic
967119733 3:186372064-186372086 CAAACAAAACTAAAGCATGCAGG - Intergenic
968410097 4:383068-383090 AAAAGATAACAGAAGCATTTAGG - Intronic
968421294 4:487270-487292 AAAAGATAACAGAAGCATTTAGG - Intronic
968707703 4:2089961-2089983 AAAAGAAACCAGAATCATGTAGG - Intronic
969349665 4:6591150-6591172 CAAAAAAAAAAGAAGGCTGGAGG + Intronic
969376283 4:6765449-6765471 CAAAGGAGAGAGAAGCCTGGGGG + Intergenic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
970100537 4:12516119-12516141 CAAACAAACCAGAAGCATTCAGG - Intergenic
970133680 4:12898316-12898338 CTAAGAAAACAGTAGCATTAAGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970492537 4:16589369-16589391 TGTAGAAAATAGAAGCATGGTGG + Intronic
970999981 4:22311142-22311164 CAAAGAAATAAGAAGCAGAGAGG + Intergenic
972136398 4:35900052-35900074 CAAATAAAATACAAGCAAGGAGG - Intergenic
972613010 4:40672542-40672564 CAAAGAGAACAGAGGCACAGTGG + Intergenic
972901351 4:43687947-43687969 CAAACAAAACAGAAGACAGGTGG + Intergenic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973928486 4:55764817-55764839 CAAACAAAATCCAAGCATGGTGG + Intergenic
974202077 4:58655530-58655552 CATAGAAAACAAGAGGATGGAGG - Intergenic
975349936 4:73333879-73333901 CAAAAAAAAAAGTAGCAAGGAGG - Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
975804176 4:78095762-78095784 CAGAGATAACTGAATCATGGGGG - Intronic
976108052 4:81640432-81640454 CAAAGGAGAAACAAGCATGGTGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976244425 4:82993177-82993199 CAAATCAAACAGAAGCAAAGAGG - Intronic
977744091 4:100524634-100524656 AAAAAAAAAAAAAAGCATGGGGG + Intronic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
977860888 4:101958456-101958478 AAAAAAAAAAAAAAGCATGGGGG - Intronic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979040319 4:115783029-115783051 CAAAGGAAAGTCAAGCATGGTGG + Intergenic
979053821 4:115971039-115971061 CACAAAAAACCCAAGCATGGTGG + Intergenic
979148542 4:117277988-117278010 GAAAGGCAACAGAAGAATGGAGG + Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
979524283 4:121701413-121701435 GAAAGAAAAAAGAGCCATGGGGG - Intergenic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
982316070 4:154033458-154033480 CAAAAAAAAAAAAAGGATGGTGG + Intergenic
982371857 4:154642373-154642395 CAATGAAAAGTGAAGCCTGGTGG - Intronic
982607576 4:157534301-157534323 AAAAGAAAAGAGAAGCAGTGAGG - Intergenic
983045252 4:162979528-162979550 CAAAGAAAAATGAAGCATATTGG - Intergenic
983316139 4:166134654-166134676 CAAAGCAAAGAAAAGCAGGGTGG - Intergenic
983317301 4:166148724-166148746 TCATGAGAACAGAAGCATGGGGG - Intergenic
983506513 4:168558691-168558713 CAATGGAAGCACAAGCATGGTGG - Intronic
984019173 4:174464143-174464165 CAAATAAACCAGAAGAAAGGAGG + Intergenic
984826609 4:183930490-183930512 CAAAAAAAAAAGGGGCATGGTGG - Intronic
984875315 4:184362660-184362682 CAAAGAAAACAGAAACAGAGAGG + Intergenic
985186782 4:187326065-187326087 CATGGAAAACACAAACATGGAGG - Intergenic
985317070 4:188669401-188669423 ATAAGAATACAAAAGCATGGGGG + Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987395034 5:17415253-17415275 AAAAGAAAACAGAATCATTTAGG + Intergenic
987415641 5:17658875-17658897 CAAAGCAAACAAAAGCATAAAGG - Intergenic
987515954 5:18908202-18908224 CAAAGAAAACAGAATCAATTAGG + Intergenic
987600526 5:20062969-20062991 GAAAGAAAAAAGAAGCATATTGG - Intronic
987844578 5:23265915-23265937 CAAAGAAAACTGATAAATGGAGG - Intergenic
988085895 5:26475378-26475400 CCAAGAAAACAGAAGCACAGAGG - Intergenic
988319650 5:29677070-29677092 CAATGAAGACAGAGGCATGGGGG + Intergenic
988351918 5:30119379-30119401 CAAAGAAATGACAAACATGGTGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988547832 5:32174440-32174462 CAAAGAAAAGACAAGCACCGAGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990096813 5:52125032-52125054 CAAAAAAAAAAGAAGCATAATGG + Intergenic
990541174 5:56773749-56773771 AAAAGAAAACAAAAGAATGTTGG - Intergenic
991195851 5:63931202-63931224 CAAAGGAAAGAGAAGCTTGATGG + Intergenic
991203703 5:64024477-64024499 CAAGGAAGAAAGAAGAATGGAGG - Intergenic
991598954 5:68333548-68333570 CCAAGAAAACTGGAGCATGTAGG + Intergenic
992297032 5:75336184-75336206 CAAAGAGAACATAAGCAGGGAGG + Intergenic
992519991 5:77540704-77540726 CAAAGAAAAGAAAAGAATGTAGG + Intronic
992725535 5:79603466-79603488 CAGACATAACAGAAGCATGTTGG + Intergenic
992839681 5:80675817-80675839 CTAAGCCAACACAAGCATGGTGG + Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993189284 5:84660652-84660674 CAAAGCCAACAGAAGAATTGAGG - Intergenic
993262087 5:85670658-85670680 CACAGAAAAATGAAGCAAGGGGG + Intergenic
993277640 5:85881349-85881371 CAAAGAAAAAAAAATCATGAAGG - Intergenic
993593321 5:89823154-89823176 CAAAGGAAAGTGAGGCATGGAGG + Intergenic
993743395 5:91566057-91566079 CAAAGAAGACAGAAATATGTGGG - Intergenic
993856354 5:93080837-93080859 AAAAGAAAACAGAAACATAGGGG - Intergenic
994098284 5:95867379-95867401 CAATCACAACAGAAACATGGTGG - Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994694976 5:103062686-103062708 TCAAGAGAACAGCAGCATGGGGG - Intergenic
995349776 5:111161769-111161791 TCATGAAAACAGAAGTATGGGGG - Intergenic
996219034 5:120906257-120906279 CATAGAAAACAAAAGCAAGAAGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
997098713 5:130943673-130943695 CAAAAACAACAGAAGAAGGGGGG + Intergenic
997769081 5:136536380-136536402 CAAAGAAAATAGTAGAAAGGAGG - Intergenic
997817425 5:137032789-137032811 CGATGAACTCAGAAGCATGGTGG + Intronic
998016337 5:138735188-138735210 AAAAAAAAAAAAAAGCATGGAGG - Intronic
998154880 5:139779702-139779724 GAAAGAAATCAGAACAATGGGGG - Intergenic
998209371 5:140182790-140182812 CTATGAAAACAGAAGAAAGGGGG + Intronic
998708679 5:144795514-144795536 TAAAGAAAACAAAAGAATGAAGG - Intergenic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999609983 5:153358725-153358747 CAAAGAAAAGAGAGGAATTGCGG - Intergenic
1000125848 5:158243184-158243206 GTAAGAAACCAGATGCATGGAGG + Intergenic
1000970961 5:167714249-167714271 CAAAGAAAACCGCACCATGGGGG - Intronic
1001730379 5:173950117-173950139 CAAATATAACAGATGAATGGAGG - Intronic
1002672347 5:180878336-180878358 TCAGGAAAACAGCAGCATGGGGG + Intergenic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003121325 6:3321145-3321167 CACGGAAAACATATGCATGGAGG - Intronic
1003711583 6:8598219-8598241 CAAAGCAAACAAAAACATGAAGG - Intergenic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004388791 6:15192084-15192106 CAAACAAAAAAAAAGCGTGGTGG - Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1004953358 6:20700161-20700183 AGAATAAAACAGAAGCAAGGTGG - Intronic
1005152419 6:22767524-22767546 GAAGGAAAAAAGAAGCATAGTGG - Intergenic
1005198838 6:23319922-23319944 CAAAGGATACAGGAGCATAGTGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005501904 6:26436169-26436191 AAAAAAAAAAAAAAGCATGGCGG - Intergenic
1006102845 6:31696649-31696671 AAAAGAAAAAAGAAACATTGTGG + Intronic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006241345 6:32682007-32682029 CAAAGAGAAAAGAAGAGTGGGGG + Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006420728 6:33932192-33932214 GATAGAAGACAGAAGCCTGGTGG + Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1007865996 6:44971551-44971573 TGATGAGAACAGAAGCATGGGGG + Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008209858 6:48707734-48707756 CACAGAAAAAAAAATCATGGAGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008439110 6:51512027-51512049 CCTAGAAAACAGAAGCATTTAGG + Intergenic
1008464563 6:51816333-51816355 CACAGAGCACAGAGGCATGGGGG - Intronic
1008674119 6:53801233-53801255 TAAATACAACAGTAGCATGGAGG - Intronic
1008748080 6:54697710-54697732 CAATGAAAACAGAATGATGAGGG + Intergenic
1009691865 6:67045085-67045107 CAAAGAAAAAAAAAACATGGAGG - Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1010259612 6:73800007-73800029 CAAAAAAAAAATTAGCATGGTGG - Intronic
1010479504 6:76333650-76333672 CAAAGCAAACAGAAACATAAAGG - Intergenic
1010968942 6:82243752-82243774 CAATGAAAATACAAACATGGTGG - Intronic
1011010727 6:82701231-82701253 AAAAGAAAAAAGAAGCAGGAAGG - Intergenic
1011074649 6:83425573-83425595 CCAGGAGAACAGCAGCATGGGGG + Intronic
1011105054 6:83770126-83770148 CCAAGCAAACAGAAGCCTAGGGG - Intergenic
1011381460 6:86746382-86746404 GAAAGAAGAGAGAAGCATTGGGG - Intergenic
1011476881 6:87757019-87757041 CACAGAAAGCAGAAGCTTGTGGG + Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011614196 6:89183098-89183120 CAAGGAAAACATATGCATGGAGG + Intronic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1012622861 6:101368277-101368299 AAAAGAAGACAGATGCATGCAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013199915 6:107883952-107883974 CAAAGAAAGCAGAAACAGGCGGG + Intronic
1013480376 6:110547821-110547843 CAAAGAAATTAGAAGCAGGAAGG - Intergenic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013721892 6:113040201-113040223 CAAAGAAGAGAGAAGCAAGGAGG - Intergenic
1014670874 6:124302058-124302080 CAGAGATAACTGAATCATGGGGG + Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1016468642 6:144351640-144351662 CAAAGAGCACAGAATCATAGGGG - Intronic
1017203540 6:151780513-151780535 CAAGGAAATCAGAATCTTGGGGG - Intronic
1017433869 6:154397523-154397545 AAAAGAAAAAACAAGCATGGTGG - Exonic
1017727127 6:157283606-157283628 CAAAGAAATCAGAAGCTCTGGGG + Intergenic
1018162508 6:161059942-161059964 CACAGAAAATAGAAACATGTGGG - Intronic
1018527378 6:164728176-164728198 AAAAGAAAACAGGAACATGTGGG + Intergenic
1018836554 6:167488631-167488653 CTAAGGAAACTGAAGCTTGGAGG - Intergenic
1020669864 7:11093457-11093479 CAAAGAAATCTGAAGCCTTGTGG - Intronic
1020756448 7:12209986-12210008 AAAACAAATCAGAATCATGGGGG - Intergenic
1020891316 7:13881212-13881234 CAAAGACAACAGAAATCTGGAGG - Intergenic
1020979001 7:15044587-15044609 CAAAGAAAACAGCAGACTAGAGG - Intergenic
1021127729 7:16872639-16872661 CAAAGGAAACAAAAGCATAAGGG + Intronic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1022741564 7:33127179-33127201 CAAAAAAAAACCAAGCATGGTGG + Intergenic
1023494707 7:40782786-40782808 CAAAAACAACAGGAGCATAGAGG + Intronic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023685566 7:42731308-42731330 TCACGAGAACAGAAGCATGGGGG - Intergenic
1024217489 7:47259675-47259697 CAAAGAGGAGAGAAGCAAGGAGG + Intergenic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1025183555 7:56838150-56838172 GAAAGAAGACATGAGCATGGTGG - Intergenic
1026051435 7:66950347-66950369 CTATGAGAACAGCAGCATGGGGG - Intronic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026257974 7:68729206-68729228 CTAAAGAAATAGAAGCATGGAGG - Intergenic
1026528731 7:71178639-71178661 CAAAGATAGCAGAAGCATCTGGG - Intronic
1026537195 7:71248726-71248748 CTAAGAACAAAGAAGCATGGGGG - Intronic
1026812236 7:73477993-73478015 CAAAGAAAACAAAGACAGGGAGG - Exonic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1028289151 7:89044139-89044161 CCAGGAAAACAACAGCATGGGGG - Intronic
1028348778 7:89817338-89817360 AATAGAAAACTGAAGCTTGGAGG - Intergenic
1028538291 7:91913916-91913938 GAAGGAAAACAGAGGCAGGGAGG + Intergenic
1028576574 7:92358583-92358605 AAAAAAAAAAAGAATCATGGGGG - Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029611403 7:101628462-101628484 AAAAGAAAACAGAAAACTGGAGG + Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029777601 7:102694720-102694742 CAAAGAAACCAGATTCATAGTGG + Intergenic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1030039746 7:105439084-105439106 GAAAGGCCACAGAAGCATGGAGG - Intergenic
1030418895 7:109282147-109282169 CAAAGCAATCCAAAGCATGGAGG - Intergenic
1031318373 7:120287689-120287711 CTAAAAATACACAAGCATGGTGG + Intronic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1032337848 7:131042879-131042901 CAAGGATAAAAGAAGCATGGCGG - Intergenic
1032401941 7:131629850-131629872 CAAAAGAAACAGATACATGGTGG + Intergenic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032897758 7:136270334-136270356 TAATGAGAACAGCAGCATGGAGG - Intergenic
1033095485 7:138426950-138426972 AAAAAAAAAAAGAAGCAAGGAGG - Intergenic
1034080034 7:148268199-148268221 CAATGAAAACAGTAAGATGGTGG + Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034623630 7:152475592-152475614 CAATGAGAACAGCAGCATGCTGG + Intergenic
1034918911 7:155062756-155062778 GAAAGAAAACAGAAACACGTGGG - Intergenic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036109377 8:5880412-5880434 CAAAGCAAACAAAAACAAGGTGG + Intergenic
1036293719 8:7518105-7518127 CAAAAGACACAAAAGCATGGCGG - Intergenic
1036328842 8:7802890-7802912 CAAAAGACACAAAAGCATGGCGG + Intergenic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1037345152 8:17890848-17890870 TCACGAAAACAGCAGCATGGGGG + Intronic
1037691740 8:21186530-21186552 TAAAGAGAAGAGGAGCATGGAGG - Intergenic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1038445483 8:27601044-27601066 CAAAAAAAAGACAAGCTTGGAGG - Intronic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1039345036 8:36693936-36693958 CAAATAAACGAGATGCATGGAGG - Intergenic
1039350265 8:36756538-36756560 CAGAGATAACTGAATCATGGAGG + Intergenic
1039748104 8:40450572-40450594 CAAAGCAAACAGAAACAAAGTGG - Intergenic
1039989496 8:42475754-42475776 CAAGGCAAGCAGAAACATGGAGG + Intronic
1040115870 8:43618233-43618255 CAAAAAAAAAAAAAGCATTGAGG + Intergenic
1040417500 8:47208056-47208078 CAAAGCAAAAAAAATCATGGGGG + Intergenic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1040629532 8:49194336-49194358 AAAAGAAAAAAAAATCATGGTGG + Intergenic
1040660859 8:49573447-49573469 GAAAGAAGCCAGTAGCATGGTGG - Intergenic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040740686 8:50571109-50571131 CAAAGCAAAGAGGGGCATGGGGG - Intronic
1040931528 8:52740215-52740237 CAAAGAAAACAGGAAGAGGGTGG + Intronic
1040995047 8:53392656-53392678 GTAAGAAAACAGAAGCACTGAGG - Intergenic
1041213820 8:55579967-55579989 CAAAGATAAAAGAAGCATAACGG + Intergenic
1041442508 8:57912201-57912223 CAAAGCACACAGAAGCTTGGGGG + Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042213254 8:66402878-66402900 CAAAGAAGACAGGAGCCAGGAGG + Intergenic
1042527626 8:69780819-69780841 CAAATAAAAAAGAAGCATACAGG + Intronic
1042726639 8:71886273-71886295 GAAAGATAACTGAATCATGGTGG - Intronic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1043179869 8:77075158-77075180 CAAGGAAAACCAAGGCATGGAGG + Intergenic
1043637402 8:82403467-82403489 CAAAGAAAATAGAAACTTAGAGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044132477 8:88542312-88542334 CAAAGAAAAAAAATGTATGGAGG + Intergenic
1044145398 8:88707573-88707595 CAATGAGAACAGAAGCACAGAGG - Intergenic
1044298788 8:90559024-90559046 CAAAGAAATCAGATGCACGAAGG + Intergenic
1044751211 8:95417463-95417485 CAAAGAACACAGAAGCAGCCTGG - Intergenic
1044947497 8:97403633-97403655 CAAAGCAAACAAAAACATGAAGG - Intergenic
1046467544 8:114626018-114626040 CAAAGTAAACAAAAGCAAAGTGG + Intergenic
1046598355 8:116288096-116288118 TGAAGAAAGCATAAGCATGGTGG + Intergenic
1046917272 8:119691074-119691096 TCAAGAGAACAGCAGCATGGGGG - Intergenic
1046917522 8:119692887-119692909 TCAAGAGAACAGCAGCATGGGGG - Intergenic
1046987011 8:120399037-120399059 CAAGGAAAACAGAACCAAGTTGG + Intronic
1047894111 8:129345811-129345833 AAAAGAAAACAGAATTAAGGGGG + Intergenic
1048009107 8:130442800-130442822 CAAAGAAAAAAGAAACTTGCCGG - Intronic
1048158801 8:131992013-131992035 AAAAGAAAAGACAAGTATGGGGG - Intronic
1048719199 8:137303627-137303649 CAAAGAAGAGAAAAGCATGAAGG - Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049103404 8:140596284-140596306 TAAAGAAAACAGAAGCTGGCTGG + Intronic
1049824652 8:144660984-144661006 CAAAAAAAAAATAGGCATGGTGG + Intergenic
1050099956 9:2108389-2108411 GCAAGAAACCAGAAGCATGCAGG + Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1050623027 9:7474417-7474439 CCAGCAAAACAGAAGGATGGGGG + Intergenic
1050816790 9:9823394-9823416 CAAAGACAGCACAAGCCTGGAGG + Intronic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051322688 9:15925681-15925703 TAAAGAAAACAGTGGAATGGGGG + Intronic
1051562495 9:18457487-18457509 CTAAGAAAAAAAAGGCATGGTGG - Intergenic
1051565678 9:18495241-18495263 AAATGAAAACATAAGCATGCAGG + Intronic
1051641761 9:19230503-19230525 AAAAGGGAACAGAAACATGGCGG + Exonic
1053197049 9:36127492-36127514 CAAAAAATACAAAGGCATGGTGG + Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053571847 9:39318088-39318110 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053622375 9:39832922-39832944 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053882764 9:42612258-42612280 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1053889905 9:42682044-42682066 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054093401 9:60876799-60876821 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054114884 9:61152719-61152741 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054125298 9:61300923-61300945 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054221791 9:62419726-62419748 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054228923 9:62489447-62489469 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054592872 9:67029815-67029837 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056408577 9:86301525-86301547 CAAGGAAAAAAGAAGCAAAGAGG - Exonic
1056897061 9:90560709-90560731 AAAAGAAAAGATAAGCATGCTGG - Intergenic
1056946390 9:91001198-91001220 CAATGAACTGAGAAGCATGGAGG + Intergenic
1057514786 9:95711957-95711979 AAAAAAAAAAACAAGCATGGTGG - Intergenic
1058317123 9:103581983-103582005 AAAAGAAAACAGAAAGATGTGGG - Intergenic
1059251826 9:112892647-112892669 CAGAGAACTCAGAAGCCTGGGGG - Intergenic
1059563683 9:115360752-115360774 AGAAGAAAACAGAAGCCTGGTGG + Intronic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1059742344 9:117164412-117164434 AAAAGTGAACAGAAGCCTGGAGG + Intronic
1059796066 9:117698248-117698270 TAATGAGAACAGCAGCATGGGGG - Intergenic
1059828634 9:118065116-118065138 CAAAGCAAACAAAAACATGAAGG - Intergenic
1059976684 9:119725189-119725211 CAGACAAAACAAAAGCTTGGAGG - Intergenic
1060161189 9:121366694-121366716 CAAAGAAAAAGGAAGCAGGCAGG - Intronic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1060696096 9:125710421-125710443 GAAGGAAAGCAGAAGGATGGAGG + Intergenic
1060722498 9:125988463-125988485 TAAAGAAATGAGAAGCAGGGAGG - Intergenic
1061365292 9:130169607-130169629 CATAGAAACCAGAAACACGGGGG - Intergenic
1061586083 9:131569579-131569601 CAAAAAAAAAAGAAACATGGAGG - Intergenic
1062033178 9:134371272-134371294 CAAAGGACACAGAGGCCTGGGGG - Intronic
1062650909 9:137576893-137576915 AAAAAAAAAAAGAGGCATGGTGG + Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1185895581 X:3855627-3855649 CAAAAACAACAGACGCATGTTGG - Intergenic
1185900700 X:3894051-3894073 CAAAAACAACAGACGCATGTTGG - Intergenic
1185905816 X:3932490-3932512 CAAAAACAACAGACGCATGTTGG - Intergenic
1186069931 X:5808595-5808617 TCAAGAGAACAGCAGCATGGTGG + Intergenic
1186359771 X:8828283-8828305 CAAAGAAAAAAGAAATATGAAGG + Intergenic
1186464391 X:9773709-9773731 CCAAAAATACAGAAGCATGGTGG + Intronic
1186888441 X:13938055-13938077 TAAGGAGAACAGAAGCACGGCGG + Intronic
1187125271 X:16448657-16448679 CAAAGGAAACAGAAACAGAGAGG - Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1189253307 X:39618256-39618278 TAAAGAAAACAAAAGTAGGGAGG + Intergenic
1189590794 X:42508559-42508581 CAGGGAAAACAGAACCATGTTGG + Intergenic
1189737951 X:44090431-44090453 CAAAAAAAAAAGAAGCATGGGGG - Intergenic
1189950569 X:46226220-46226242 TAAAGAAAACACATGCAAGGGGG - Intergenic
1191699333 X:64022707-64022729 TAAAGAAAACTGAACCATAGTGG + Intergenic
1191852653 X:65597188-65597210 AAAAGAAAAGCCAAGCATGGTGG - Intronic
1191867468 X:65716574-65716596 CAAAGAACAGACAAGCATGAAGG - Intronic
1192170090 X:68848994-68849016 TGAATAAAACAGAAGCACGGAGG - Intergenic
1192718821 X:73670204-73670226 CACAGAGAACAAAAGCAGGGTGG - Intronic
1193021881 X:76800512-76800534 CACAGAAAACTGAGACATGGGGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1194297993 X:92150946-92150968 CAAACAAAACAGAAGTATAACGG - Intronic
1195318434 X:103700987-103701009 CAAAGAAAAAAGAAACTTGGTGG + Intergenic
1195996938 X:110741045-110741067 AAAGGAAAACAGATCCATGGAGG + Intronic
1196320324 X:114280280-114280302 AAAAGCAGACAGTAGCATGGTGG - Intergenic
1197464465 X:126785564-126785586 AAAAAAAAATAGAAGGATGGTGG + Intergenic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1197868690 X:131045494-131045516 CACAGAAAAGAGACACATGGAGG - Intergenic
1197894855 X:131301977-131301999 CAATGAAAATAGCAGGATGGGGG + Intronic
1198021367 X:132661655-132661677 AAAAGAAAAAAGAAGCCTGCTGG - Intronic
1198250374 X:134874261-134874283 TCACGAAAACAGCAGCATGGGGG + Intergenic
1198427459 X:136534058-136534080 TAAAGCAATGAGAAGCATGGAGG - Intronic
1198653456 X:138888872-138888894 CAAAGATATCAGAAGAATGATGG - Intronic
1199322071 X:146451687-146451709 CAAATTAAACACAAGCATGCAGG + Intergenic
1199394644 X:147320969-147320991 CAAAGAGAACATTAGCAAGGAGG - Intergenic
1200053781 X:153447923-153447945 AAAAGAAACCAAAAGGATGGTGG + Intronic
1200615602 Y:5375917-5375939 CAAACAAAACAGAAGTATAACGG - Intronic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic