ID: 1181399477

View in Genome Browser
Species Human (GRCh38)
Location 22:22642873-22642895
Sequence GCTGAGGCCCAGAAATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181399476_1181399477 -8 Left 1181399476 22:22642858-22642880 CCTGCTGCAGCTGTGGCTGAGGC No data
Right 1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG No data
1181399470_1181399477 30 Left 1181399470 22:22642820-22642842 CCGGGAGGTCTGCGATCTCTGGT 0: 1
1: 38
2: 13
3: 17
4: 124
Right 1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG No data
1181399473_1181399477 2 Left 1181399473 22:22642848-22642870 CCTCTGGGCACCTGCTGCAGCTG No data
Right 1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181399477 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG Intergenic
No off target data available for this crispr