ID: 1181401693

View in Genome Browser
Species Human (GRCh38)
Location 22:22653643-22653665
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3178
Summary {0: 10, 1: 1, 2: 17, 3: 303, 4: 2847}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181401693 Original CRISPR ATGGGGGAATGGAGGGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr