ID: 1181405260

View in Genome Browser
Species Human (GRCh38)
Location 22:22679902-22679924
Sequence CAGGGTCTTTTGAGCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181405255_1181405260 5 Left 1181405255 22:22679874-22679896 CCATGTGGGGTCAAGCTCAGTCT No data
Right 1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG No data
1181405254_1181405260 6 Left 1181405254 22:22679873-22679895 CCCATGTGGGGTCAAGCTCAGTC No data
Right 1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181405260 Original CRISPR CAGGGTCTTTTGAGCTCTGG AGG Intergenic
No off target data available for this crispr