ID: 1181406574

View in Genome Browser
Species Human (GRCh38)
Location 22:22689212-22689234
Sequence AAAAATAAGTAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181406567_1181406574 26 Left 1181406567 22:22689163-22689185 CCCAGGAGCCTTCACAGTCTTTC No data
Right 1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG No data
1181406569_1181406574 18 Left 1181406569 22:22689171-22689193 CCTTCACAGTCTTTCTCAAATGG No data
Right 1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG No data
1181406568_1181406574 25 Left 1181406568 22:22689164-22689186 CCAGGAGCCTTCACAGTCTTTCT No data
Right 1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181406574 Original CRISPR AAAAATAAGTAGAGGGAGGC TGG Intergenic
No off target data available for this crispr