ID: 1181410768

View in Genome Browser
Species Human (GRCh38)
Location 22:22717170-22717192
Sequence ATTCTTTCCTGGGGCGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181410755_1181410768 22 Left 1181410755 22:22717125-22717147 CCAGTCCCCCTTGTCAAAGGCCA No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410759_1181410768 14 Left 1181410759 22:22717133-22717155 CCTTGTCAAAGGCCATCCCATAC No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410758_1181410768 15 Left 1181410758 22:22717132-22717154 CCCTTGTCAAAGGCCATCCCATA No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410757_1181410768 16 Left 1181410757 22:22717131-22717153 CCCCTTGTCAAAGGCCATCCCAT No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410762_1181410768 -3 Left 1181410762 22:22717150-22717172 CCATACCTGCACCATTTCTTATT No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410763_1181410768 -8 Left 1181410763 22:22717155-22717177 CCTGCACCATTTCTTATTCTTTC No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410761_1181410768 -2 Left 1181410761 22:22717149-22717171 CCCATACCTGCACCATTTCTTAT No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410754_1181410768 23 Left 1181410754 22:22717124-22717146 CCCAGTCCCCCTTGTCAAAGGCC No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410752_1181410768 28 Left 1181410752 22:22717119-22717141 CCTGTCCCAGTCCCCCTTGTCAA No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410756_1181410768 17 Left 1181410756 22:22717130-22717152 CCCCCTTGTCAAAGGCCATCCCA No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data
1181410760_1181410768 2 Left 1181410760 22:22717145-22717167 CCATCCCATACCTGCACCATTTC No data
Right 1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181410768 Original CRISPR ATTCTTTCCTGGGGCGTCAT AGG Intergenic
No off target data available for this crispr