ID: 1181413630

View in Genome Browser
Species Human (GRCh38)
Location 22:22744131-22744153
Sequence CTGAATCAACAGCAGTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181413627_1181413630 4 Left 1181413627 22:22744104-22744126 CCTGGCAGTCGGTCATCATCTGT 0: 1
1: 1
2: 2
3: 9
4: 69
Right 1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG 0: 1
1: 0
2: 0
3: 10
4: 145
1181413624_1181413630 21 Left 1181413624 22:22744087-22744109 CCTCCACTTCATGGACACCTGGC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG 0: 1
1: 0
2: 0
3: 10
4: 145
1181413622_1181413630 22 Left 1181413622 22:22744086-22744108 CCCTCCACTTCATGGACACCTGG 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG 0: 1
1: 0
2: 0
3: 10
4: 145
1181413625_1181413630 18 Left 1181413625 22:22744090-22744112 CCACTTCATGGACACCTGGCAGT 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181413630 Original CRISPR CTGAATCAACAGCAGTATTG GGG Intronic
903019296 1:20382727-20382749 CCGCCTCAACAGCAGTACTGAGG - Intergenic
907190263 1:52642183-52642205 CTTAAGAAACAGCAGTATGGGGG + Intronic
909861812 1:80615748-80615770 CTATATCAACAGTAATATTGGGG + Intergenic
910781169 1:90935328-90935350 CTGAATTAACACCAGTCTGGTGG + Intronic
911883086 1:103266391-103266413 CTAAATTAATAGCATTATTGAGG - Intergenic
916717573 1:167458111-167458133 CTGTATTAACACCAGTATTTTGG - Intronic
918751815 1:188281631-188281653 CTGAAGTAAGAGCAGTCTTGTGG - Intergenic
918934776 1:190907365-190907387 CTGAATCTGCAGCAGAATTTGGG + Intergenic
919284738 1:195541972-195541994 CTGAAACACCAGCACTCTTGGGG + Intergenic
919790670 1:201288827-201288849 CTGAAAGAGCAGCAGGATTGTGG + Intronic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923088359 1:230719273-230719295 CTGAATCAACAGCAGTCCATAGG - Intergenic
924370984 1:243349385-243349407 CTGCAACAACAGCAGAGTTGAGG + Intronic
1063242332 10:4183947-4183969 CTAAATAAACAGCAGAAATGTGG - Intergenic
1065890357 10:30116175-30116197 CAGAATCAACAGCAAAAATGAGG + Intergenic
1066700305 10:38120658-38120680 CTGAATCAAGTTCAGTATTCAGG - Exonic
1072019390 10:91383194-91383216 CTGACTCCACAGCAGTTTTGGGG + Intergenic
1074646663 10:115460781-115460803 CTGAATGAACATCAGTCTTTTGG - Intronic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1076295462 10:129380475-129380497 CTGAATCCACAGCAGAGATGCGG + Intergenic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1079943404 11:26710786-26710808 CTGAATTAAATGCAATATTGAGG + Intronic
1080421039 11:32110654-32110676 CTGAATCAGAGGCAGTATAGTGG - Intergenic
1087994977 11:104794328-104794350 CATAATAAACAGCAATATTGTGG - Intergenic
1091089023 11:132751781-132751803 CTGAATAAACAGCAGTTCAGTGG - Intronic
1091811180 12:3399122-3399144 ATGAAGCAACAGAAGTATGGTGG - Intronic
1093006464 12:14057011-14057033 CTGAATCAAGAGCAGAATGCTGG - Intergenic
1093171191 12:15862695-15862717 CTGAAAGAAGAGCAGTTTTGGGG - Intronic
1095546132 12:43372638-43372660 ATGATTCAGCAGCAGAATTGAGG + Intronic
1095935093 12:47670866-47670888 CCAAACCAACAGCAGTATTGTGG + Intronic
1097638686 12:62152724-62152746 CCAAATCACCAGCATTATTGTGG + Intronic
1100350265 12:93774460-93774482 CAGAATAAACAGCAGCATTTGGG - Intronic
1106126680 13:26905633-26905655 CTGAAATAGCAGCAGTAATGAGG + Intergenic
1107850070 13:44562435-44562457 CCGAATAAACATTAGTATTGTGG + Intronic
1109828250 13:67752490-67752512 CTGGATGAACAGTAGTCTTGTGG - Intergenic
1110984682 13:81952220-81952242 CTGATATAACAGCAGTGTTGTGG + Intergenic
1116171269 14:41406131-41406153 CAGAATCAACTGCAGCATTAGGG - Intergenic
1116937292 14:50754311-50754333 CTTTATCATCAGCAGAATTGAGG - Intronic
1118169517 14:63373341-63373363 TTGCAGCAACAGCAGAATTGTGG + Exonic
1121626754 14:95390792-95390814 ATGAATTAACACCATTATTGTGG + Intergenic
1123850231 15:24348014-24348036 CTAAATCAACAGTTGTATAGAGG + Intergenic
1123855174 15:24402576-24402598 CTAAATCAACAGTTGTATAGAGG + Intergenic
1123871200 15:24575509-24575531 CTAAATCAACAGTTGTATAGAGG + Intergenic
1126821766 15:52511379-52511401 CTGAATCAGGAGAAGTAATGTGG - Intronic
1130331830 15:82928252-82928274 CAGAATCAACAGCTTTATTTAGG - Intronic
1133488681 16:6246036-6246058 CTGAATAATCAGAATTATTGTGG + Intronic
1135397869 16:22145003-22145025 CAGAACCATCATCAGTATTGGGG - Intronic
1141750770 16:85956428-85956450 ATGAATAAACAGAAGTATTCTGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1203175624 17_KI270729v1_random:10895-10917 CTGAATCAACAGAAGTGTAATGG - Intergenic
1155137818 18:23013922-23013944 GTCAATGAACAGTAGTATTGAGG - Intronic
1157974650 18:52313409-52313431 CTGAATGAACACCAGTCCTGTGG + Intergenic
1159948162 18:74458618-74458640 CTCAATCAACAGCAGGGTTTGGG + Intergenic
1162213761 19:9114938-9114960 CTGAAGCCACAGCAGTAATTCGG + Exonic
1163047449 19:14654623-14654645 CTGAATAAACAACTTTATTGAGG + Intronic
925404600 2:3597801-3597823 CTGCCTCAGCAGCAGTATTTTGG - Intronic
926057150 2:9780587-9780609 GTGTTTCAACAGCAGTGTTGAGG - Intergenic
926282113 2:11458235-11458257 GAGAATCAACAGCAGTACTAGGG + Intronic
929334363 2:40722631-40722653 ATGAATCAGCAGCAGAGTTGTGG + Intergenic
929388828 2:41443631-41443653 CAGAATCAACAATAGTATTCTGG - Intergenic
931978345 2:67667707-67667729 CTCAATCACAAGCAGTTTTGTGG - Intergenic
934095940 2:88604107-88604129 CTGAAACAACAGCAGAAATTGGG - Intronic
935398926 2:102640386-102640408 CTGAATCATGGGCAGTTTTGTGG - Intronic
937964001 2:127487266-127487288 CTGTATCAACATCAGTATCCTGG - Intronic
940276204 2:151943287-151943309 CAGAACCAGCAGCACTATTGGGG - Intronic
940710163 2:157153506-157153528 CGGAATCAACATCAGAATTAAGG - Intergenic
940892320 2:159047036-159047058 CTGAAGCCACAGAATTATTGAGG - Intronic
941293987 2:163713381-163713403 CTAAATAAACAGCAGTATAAAGG + Intronic
942989627 2:182183879-182183901 TGAAATCAACAGCAGGATTGAGG + Intronic
944199991 2:197096345-197096367 CTGCCTCAACAGCAGAATTAGGG - Intronic
945130416 2:206565614-206565636 CTGAAGCAACAGCAGCTCTGGGG - Intronic
945688651 2:213005490-213005512 ATGAGTTAAGAGCAGTATTGGGG + Exonic
1174439385 20:50537448-50537470 CTGTATCAATGTCAGTATTGTGG - Intronic
1178579274 21:33824030-33824052 CTGTATAAACAGAAGTATTCTGG + Intronic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG + Intronic
1183002621 22:34874371-34874393 CTGAATGAGCAGCAGGATTCAGG + Intergenic
1183095294 22:35548399-35548421 CTGACTCAACAGAAGACTTGGGG - Intronic
949111248 3:263209-263231 CTAAATCACCAGCAGTCTCGGGG - Intronic
952384799 3:32832518-32832540 CTGAATGAACAGTACTCTTGGGG + Intronic
955241037 3:57178408-57178430 GTGAGTCAGCAGCAATATTGCGG - Intergenic
958009595 3:87859566-87859588 CTGAATCACAAGCAGTATGCCGG - Intergenic
958877836 3:99636316-99636338 TTGAATAAACAGCAATATTGAGG - Intergenic
976505443 4:85840556-85840578 CTGGATCCACAGCAGTTATGAGG - Intronic
976841366 4:89436467-89436489 CAGAATAAACAGCACTATGGAGG - Intergenic
977399730 4:96517519-96517541 CTGAAAAAACAGCTGTATTGTGG + Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978319924 4:107482149-107482171 CTGTATCCACAGCAGTATGTGGG - Intergenic
980228703 4:130020176-130020198 CTGAAGCAAGGGCAGTCTTGTGG - Intergenic
983991330 4:174123629-174123651 CTGAATGAACAGCAATCTTGGGG + Intergenic
986789985 5:11150145-11150167 CTGACTCAACAGTAGTGTGGGGG - Intronic
987445950 5:18020253-18020275 CTGAAACAATAACAGTAATGTGG + Intergenic
987610308 5:20194738-20194760 CTGAATCAACTCTAGTATTCAGG - Intronic
988680468 5:33480185-33480207 CTGATTTAACAGCAGAATGGTGG + Intergenic
989673209 5:43944332-43944354 CTGAGGCATCAGCAGTCTTGGGG + Intergenic
991036358 5:62131634-62131656 CAGAATCAATAGGAGCATTGAGG - Intergenic
992226156 5:74621202-74621224 CTGAAGCAAGGGCAGTCTTGTGG - Intergenic
992752906 5:79877479-79877501 CTGAATAAAAAGCTGCATTGCGG - Intergenic
993681928 5:90889350-90889372 TTGAATTAACATCAGCATTGTGG + Intronic
993870025 5:93241707-93241729 CTGAATAAACAGATGTTTTGTGG + Intergenic
995359598 5:111279991-111280013 CGGTATTCACAGCAGTATTGAGG + Intronic
997118481 5:131150762-131150784 CTGAGTCAACAGCATAATGGTGG + Intergenic
997284903 5:132670928-132670950 CTGAAGCAAGGGCAGTGTTGTGG + Intergenic
997891839 5:137683839-137683861 TTGAATCAATAGCACTATTATGG - Intronic
998711495 5:144830735-144830757 CTGAATTGTCAGCAGTATTTAGG + Intergenic
1000056517 5:157611756-157611778 CTGAATCAACCCCAGTAGAGTGG - Intergenic
1001563548 5:172685480-172685502 CTGAACCAACAGCAAGCTTGGGG + Intronic
1001903502 5:175451691-175451713 ATGAACCAAGAGCAGTTTTGGGG - Intergenic
1003724385 6:8743880-8743902 CTGAATGAACATAGGTATTGAGG + Intergenic
1003926940 6:10884969-10884991 CTGAATCAACAGGAGTTTCGGGG - Intronic
1004268738 6:14174824-14174846 CTGAAGCATCAGCAGAAGTGTGG + Intergenic
1006453461 6:34118823-34118845 CTGGTTCAACAGCAAAATTGAGG + Intronic
1007110745 6:39312344-39312366 CTGAAGCCACAGGAGTGTTGAGG + Intronic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1011291375 6:85780776-85780798 CTGAAGCGAGAGCAGTCTTGTGG - Intergenic
1011796106 6:90954300-90954322 CTGAATCAATAGAAGAATTAGGG - Intergenic
1012793520 6:103732033-103732055 CTTAATCTACAGCACTATAGAGG - Intergenic
1013731670 6:113175577-113175599 CTGAACCAACAGCAGCATCCTGG + Intergenic
1020522359 7:9207606-9207628 CTGAATCAACAACAATTTTCTGG + Intergenic
1022513532 7:30959900-30959922 AAGAATGAACAGGAGTATTGTGG - Intronic
1023720929 7:43093959-43093981 CAGAATCTAAAGCACTATTGGGG + Intergenic
1024391970 7:48824953-48824975 CTGTATTAACAACAGAATTGAGG + Intergenic
1025120969 7:56302031-56302053 TTGCAGCAACAGCAGAATTGTGG + Intergenic
1025222511 7:57126922-57126944 TCAAATCTACAGCAGTATTGTGG - Intronic
1025859489 7:65313049-65313071 CTGAATCAGTGGCAGTAATGTGG + Intergenic
1028027049 7:85856835-85856857 ATGCAACAAAAGCAGTATTGAGG - Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1033494274 7:141878060-141878082 CTGCAACAAAAGCAGTGTTGGGG - Intergenic
1033568416 7:142602226-142602248 CTGAATCAACTGCAATGTTTTGG - Intergenic
1034199216 7:149271850-149271872 CTGAATCCACAGAAGAACTGAGG - Intronic
1038763872 8:30409563-30409585 CTGACTCAACAGTCCTATTGGGG - Intronic
1039652421 8:39356608-39356630 CAGAATCAACAAAAGTATTCTGG - Intergenic
1039998304 8:42554655-42554677 CTGCTTCAACAGCTGAATTGGGG + Intergenic
1041065205 8:54076061-54076083 CTGGAACCACAGCAGTATAGTGG + Intronic
1043139455 8:76570536-76570558 CTGAAATAAAAGCAGTAATGGGG - Intergenic
1043541367 8:81266736-81266758 ATGAATCAACAGCAATACTAAGG - Intergenic
1045378076 8:101595175-101595197 CTTAATCAACAAATGTATTGAGG - Intronic
1051491719 9:17674082-17674104 CAGAATTAACAGCATAATTGTGG + Intronic
1051635345 9:19176442-19176464 TTGAATCAAAAGCAGCTTTGAGG + Intergenic
1052178900 9:25501221-25501243 CTGTATCACTAGCAGTGTTGTGG - Intergenic
1052508036 9:29380406-29380428 CTGTATGAACAGCAGTCTCGGGG - Intergenic
1055221760 9:73941910-73941932 TTTAATCAGCAGCAGTTTTGTGG - Intergenic
1055917468 9:81420381-81420403 CTGAAGCAAAAGTTGTATTGAGG + Intergenic
1058744551 9:107976960-107976982 CTGAAGCCACAGCAGTGGTGAGG - Intergenic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1060777157 9:126383322-126383344 CTGTATTAATAGCATTATTGGGG - Intronic
1061853807 9:133430466-133430488 CTGAACCCACAGCAGAAGTGGGG + Intronic
1187352646 X:18535174-18535196 CTGACTCAACTGCAGTACTCAGG - Intronic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1195416238 X:104622531-104622553 CTAAGTCATCAGCAGCATTGTGG + Intronic
1195471356 X:105234038-105234060 CTCAGTCAATAGCAGTCTTGGGG + Intronic
1195682730 X:107560950-107560972 CTGAGTCAAAAGCAGTGGTGAGG - Intronic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic