ID: 1181415319

View in Genome Browser
Species Human (GRCh38)
Location 22:22755054-22755076
Sequence GTGCCCTTCTCGAAATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181415312_1181415319 4 Left 1181415312 22:22755027-22755049 CCTAACCTCTTTGGGTCCCTTGG 0: 2
1: 0
2: 0
3: 10
4: 131
Right 1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1181415316_1181415319 -1 Left 1181415316 22:22755032-22755054 CCTCTTTGGGTCCCTTGGGGCTG 0: 2
1: 0
2: 2
3: 20
4: 154
Right 1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1181415310_1181415319 6 Left 1181415310 22:22755025-22755047 CCCCTAACCTCTTTGGGTCCCTT 0: 2
1: 0
2: 3
3: 24
4: 174
Right 1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1181415311_1181415319 5 Left 1181415311 22:22755026-22755048 CCCTAACCTCTTTGGGTCCCTTG 0: 2
1: 0
2: 1
3: 12
4: 151
Right 1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181415319 Original CRISPR GTGCCCTTCTCGAAATCACA AGG Intronic
901239300 1:7683729-7683751 GTGCCATGCTCCAAAGCACAGGG + Intronic
902298616 1:15485652-15485674 GTCCCCATCTCAAAATCTCAGGG + Intronic
912826892 1:112913099-112913121 CTGCCCTTTTTGAAATCACCTGG - Exonic
913380561 1:118205779-118205801 GTGGCCATCTCAACATCACAGGG + Intergenic
921597806 1:217073863-217073885 TTGCCCTTCTTGAAATCTAAGGG - Intronic
924446666 1:244139074-244139096 GGGCCCTGCTGGAAGTCACAGGG + Intergenic
1074336596 10:112582502-112582524 GAGCCCTTCTCCAGATCTCATGG + Intronic
1075286396 10:121190584-121190606 GTGACCTACCAGAAATCACAAGG - Intergenic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1075897234 10:126007252-126007274 GTGCCTTTCCTGAGATCACATGG - Intronic
1076034576 10:127188433-127188455 GTTCCCTTCTAGAAATTCCATGG + Intronic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1080197918 11:29633164-29633186 GTGCCTTTCTCAAAATCAGTGGG + Intergenic
1081179047 11:39965356-39965378 GTGTCCTTTTTGAAATCAGAGGG + Intergenic
1094374121 12:29772258-29772280 GTGCCCATCTCGAGAGGACAAGG + Intronic
1097480137 12:60113900-60113922 GTTGTCTTCTCAAAATCACATGG - Intergenic
1100607202 12:96161650-96161672 GTGCCCTTCTCTGCTTCACAGGG - Intergenic
1109168739 13:59069485-59069507 GTGGCCTGCTCCAAATCACAAGG + Intergenic
1114527472 14:23375776-23375798 GTGCCCTTCTCGCCATGGCATGG - Exonic
1114774870 14:25470063-25470085 CTTCCATTCTTGAAATCACATGG + Intergenic
1115458912 14:33636706-33636728 CTGCCCTTCTCAGAGTCACACGG + Intronic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121844321 14:97159760-97159782 GTGGCCTTCTCAAAGTCATAGGG + Intergenic
1126380364 15:48040300-48040322 ATGCCCTGCTCGAAGTCATACGG - Intergenic
1127457037 15:59164695-59164717 GGGCCCTTCTTGGAATGACAGGG + Intronic
1127583126 15:60355619-60355641 GTGACCTTCCCTAAGTCACACGG + Intronic
1130244773 15:82236525-82236547 GTGCCTTTGTCAAAATCACTTGG - Intronic
1131156060 15:90076385-90076407 GTGCCCTTTTGGAAATAACTGGG + Intronic
1131805543 15:96118541-96118563 GTGCCCTTCTAGATATGACAGGG - Intergenic
1135684048 16:24483499-24483521 GTGGCCTTCTGCAAATCAGAAGG - Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1138315754 16:56068596-56068618 CTGCTCTTCTCTGAATCACAGGG - Intergenic
1141143890 16:81515575-81515597 GTGGCCATCAGGAAATCACAGGG + Intronic
1143307721 17:5960842-5960864 GTGCCCATCTCCAAATCTCTGGG + Intronic
1144836775 17:18160656-18160678 ATGCCCATCTCCAAACCACAGGG + Intronic
1145777290 17:27538346-27538368 GTGGCCATCTCGCAACCACAAGG - Intronic
1147320255 17:39641737-39641759 GTGCCCTTGACCAAATCACTGGG - Intronic
1148192084 17:45686364-45686386 GTGTGCTTCTCCAAACCACAAGG + Intergenic
1148250491 17:46074931-46074953 GTACCCTTCTCTACACCACAGGG - Intronic
1150599493 17:66638402-66638424 ATGACCTTCCCCAAATCACATGG - Intronic
1152112470 17:78364994-78365016 GAGCCCTTCCCCAAATCTCATGG + Intergenic
1153230498 18:2930884-2930906 CTGCCCTTCTGGAAAGCACTGGG - Intronic
1154387657 18:13910202-13910224 GTGCCTTTGTTGAAATCACCTGG + Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1159957142 18:74526757-74526779 TTGACTTTCTCTAAATCACATGG - Intergenic
1165001890 19:32770743-32770765 GTGCCCGTAGAGAAATCACATGG + Intronic
1165126745 19:33603480-33603502 ATCCCCTTCTGGAAATCACGAGG + Intergenic
1166268873 19:41701447-41701469 GGGCCCTTCTTGAAATCCCAGGG + Intronic
927029573 2:19106358-19106380 GAGCCCTTCAGGAACTCACAGGG + Intergenic
936854131 2:116936412-116936434 GTGCCCTTCTCAAAAGGAGAAGG + Intergenic
940599803 2:155844991-155845013 GTGCCATTCTCGAAACAAAAAGG - Intergenic
1170995141 20:21348224-21348246 GTACCCTTCTCAAAATCAGATGG - Exonic
1171174738 20:23043070-23043092 GTGCCCTTCTCCATTTCTCAGGG - Intergenic
1176964433 21:15195664-15195686 ATACCCTTCTCTAATTCACATGG - Intergenic
1177859153 21:26432634-26432656 GTGCCTGTCTCGAGGTCACATGG - Intergenic
1180133378 21:45843097-45843119 GTGTCATTCTCCAAATCCCAAGG + Intronic
1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG + Intronic
1184758083 22:46528135-46528157 GTGCTTTTCTGGAACTCACAGGG - Intronic
953769110 3:45765328-45765350 GTTCCATTCTCCACATCACAGGG - Intronic
955601239 3:60647594-60647616 GTCCCCTGCTCAAAATAACAAGG + Intronic
961680657 3:128597841-128597863 GTCCCCTGCTCCAAAACACAAGG + Intergenic
963759482 3:149272692-149272714 TTGCCCTTCTCAAAATTGCAAGG - Intergenic
968077188 3:195822591-195822613 CTCCCCATCTCGAAATCACAGGG - Intergenic
970175932 4:13339480-13339502 ATGCTCTTCCCTAAATCACAGGG - Intergenic
971224461 4:24738150-24738172 GTGCCCCTACCCAAATCACATGG + Intergenic
971760672 4:30760706-30760728 GTGCCCTTTAGGAAATGACATGG - Intronic
979543375 4:121912343-121912365 ATGCACTTCTGGAAATCACAGGG + Intronic
984622352 4:181967900-181967922 GTGCCTTGCTTGAGATCACAGGG + Intergenic
984725201 4:183013667-183013689 CTGCCCTTCTCCCGATCACACGG + Intergenic
985352898 4:189085273-189085295 GTGCCCATCCCCAAAACACATGG + Intergenic
985997491 5:3605070-3605092 ATGCACTTCTCAAAATGACAGGG + Intergenic
1009339067 6:62531210-62531232 GTAACCTTCTAGAATTCACAGGG + Intergenic
1012216858 6:96597778-96597800 ATGCCCTTCTCCACATCTCAAGG + Intronic
1019691700 7:2418494-2418516 GTGCTCTGCTTCAAATCACAGGG + Intronic
1023254995 7:38304504-38304526 GTGCCCTGCTCAAAGTCACTTGG - Intergenic
1023545342 7:41312484-41312506 GTTCCCTCCTGGAACTCACAGGG - Intergenic
1028411832 7:90538349-90538371 GTGACTTTGTTGAAATCACAGGG - Intronic
1031362403 7:120862398-120862420 CAGCCCTTCTCTAAAGCACAGGG + Intergenic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1042370513 8:67985911-67985933 GTTCCCTGCTAGAAACCACATGG - Intronic
1051065920 9:13103003-13103025 GTGCCCCTCTTGAGATCCCAGGG - Intergenic
1055325235 9:75121794-75121816 CTGGCCTCCTCGAAATCACTGGG + Intronic
1060548040 9:124472046-124472068 GTGCCCCTCTCCACATCATAGGG + Intronic
1060789360 9:126475609-126475631 GTGCCCTTCTCACCAGCACAGGG - Intronic
1061114888 9:128603819-128603841 CTGCCCTACTGGAAATCAGAGGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1199790923 X:151154524-151154546 CTGCACTTCTGAAAATCACAGGG - Intergenic