ID: 1181415666

View in Genome Browser
Species Human (GRCh38)
Location 22:22756938-22756960
Sequence TTTTTTGCACAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181415666 Original CRISPR TTTTTTGCACAGAATGTGGA GGG (reversed) Intronic
900917334 1:5647956-5647978 TTTTTCCCACAGATTTTGGATGG - Intergenic
902276308 1:15342533-15342555 TTTTTAGCAAAGCATCTGGATGG - Intronic
902895574 1:19477516-19477538 TTTTGTGCTCAGAAACTGGAAGG - Intronic
903279345 1:22241677-22241699 TTTTGAGCACAGAATGTCAATGG + Intergenic
904155063 1:28476141-28476163 ATTTCTTCACTGAATGTGGATGG - Exonic
905251456 1:36651424-36651446 TATATTGCAAAGAATGTGTAAGG + Intergenic
907599030 1:55748106-55748128 TTGTTAGCCCAGAATGTGGGCGG - Intergenic
908667616 1:66510229-66510251 TGTTTTGCAAACAATGTGGACGG - Intergenic
910621798 1:89263458-89263480 TTTGTTGCAATGAATGTTGATGG + Intronic
911656754 1:100452725-100452747 TTTTTTGCATAGTATTTGGTAGG + Intronic
911666525 1:100559003-100559025 TTTTTTCCTCAGAATAAGGATGG - Intergenic
911991339 1:104701253-104701275 TTTTTTGCAAAGAAGTGGGAGGG - Intergenic
912079227 1:105914020-105914042 TTATAGGCACAGAATGGGGATGG - Intergenic
914227400 1:145732158-145732180 TTTTTCCCACAGAATTTTGAAGG - Intronic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
915698549 1:157768993-157769015 CCTTTTGCACAGAATATAGAGGG + Intronic
916211742 1:162365283-162365305 CTTCTTGAACTGAATGTGGAGGG + Intronic
917678509 1:177342351-177342373 GTGTTTACAAAGAATGTGGATGG - Intergenic
918112009 1:181463867-181463889 TTTTTATCTCAGTATGTGGAAGG - Intronic
918194897 1:182212109-182212131 TCTTTTTCACAGCTTGTGGAAGG + Intergenic
919674703 1:200369749-200369771 TTTTTAGCAGAGGATGGGGATGG - Intergenic
921456275 1:215375974-215375996 TTTTTTTCACAGAATGGGAGAGG + Intergenic
921642648 1:217573964-217573986 TATTTTGCAGAGAATGAGAATGG + Intronic
923730608 1:236546187-236546209 TTTTTTGCAGAGACAGTGAAAGG + Intronic
924718689 1:246602988-246603010 TTTTTGGGACAGAATTTGAAAGG - Intronic
1063604669 10:7512207-7512229 ATTTTTCCACAGACAGTGGAGGG + Intergenic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064920448 10:20511229-20511251 TATTTTGCAAAGGATGAGGAGGG + Intergenic
1066452217 10:35540571-35540593 TTTTTTGAAGAGTTTGTGGAAGG + Intronic
1067934471 10:50597458-50597480 TTTGATACACACAATGTGGATGG + Intronic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1069146411 10:64896924-64896946 TCTCTTGAACAGAATTTGGAGGG - Intergenic
1069203701 10:65655585-65655607 TTTTTTGTACATATTGTGAATGG - Intergenic
1069309282 10:67013490-67013512 CTTTTTGCACAGCACGTGAATGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069599991 10:69698015-69698037 TTTTTTCCTCAGCATTTGGAAGG + Intergenic
1069795031 10:71046498-71046520 TTTTGTGCACATAACGAGGAGGG - Intergenic
1071224253 10:83509552-83509574 TTTTTTCCACAGTATTTGGTTGG - Intergenic
1071310903 10:84342656-84342678 TGTTTGGAACAGAATGTAGAAGG - Intronic
1071319149 10:84435622-84435644 TTTTTTGCACTGAATGGGTAAGG - Intronic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072831087 10:98659328-98659350 TTTTTTCAACCAAATGTGGATGG - Intronic
1073641257 10:105254863-105254885 TTTTTTCAACAAAATGTGGATGG - Intronic
1076332646 10:129681641-129681663 TTTTTTCAACCAAATGTGGATGG + Intronic
1077403731 11:2372500-2372522 TTTTGTGCACAGCATGAGGTAGG + Intergenic
1078908449 11:15709013-15709035 TTTTTTGCCAAGAGAGTGGACGG - Intergenic
1079318907 11:19433514-19433536 TTTTTAGGACTGAATTTGGAAGG + Intronic
1080320431 11:31003049-31003071 CTTTTTTCACATAATTTGGATGG + Intronic
1080542175 11:33278363-33278385 TTTTGAGGACAGAATGTGAAGGG + Intronic
1080672993 11:34398485-34398507 TTTTTTGCAGAGATGGTAGAGGG - Intergenic
1081262396 11:40976844-40976866 TTTTTTCCACAGACTGGGGCAGG + Intronic
1082021731 11:47539758-47539780 ATTTTTGCTCTGCATGTGGATGG + Intronic
1082143542 11:48638165-48638187 GGTTTTCCACAGTATGTGGAAGG - Intergenic
1082173651 11:49036064-49036086 TTTTTTGCCCCAAATGTGTAAGG - Intronic
1085099969 11:73792279-73792301 TATTTTGCACAGAAAATGAATGG + Intronic
1085107348 11:73856854-73856876 TTTATTGCAGAAAATTTGGAAGG + Intronic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1085323347 11:75588329-75588351 TTCTTAGTACAGAATGTGGGCGG + Intronic
1086692118 11:89800033-89800055 TTTTTTGCTCCAAATGTGTAAGG + Intronic
1086713681 11:90039627-90039649 TTTTTTGCTCCAAATGTGTAAGG - Intronic
1087430958 11:98054482-98054504 TTATATGCACTGAATGTGCATGG - Intergenic
1088386949 11:109269048-109269070 TTTTCTGAACAAAATGTTGAAGG - Intergenic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1092104116 12:5908817-5908839 TTGTGTGCACAGAATAGGGAAGG + Intronic
1092871681 12:12811252-12811274 TTTTTTGCACAGAATTGGGGCGG - Intronic
1094043761 12:26145293-26145315 TTTCTTGAACCGAAGGTGGAAGG - Intronic
1094774773 12:33712918-33712940 TTTTTTGAAAAGAGTGTGGTTGG + Intergenic
1095757328 12:45783525-45783547 GTTTTTCCACAGACTGTGGCAGG + Intronic
1096077222 12:48813495-48813517 TTTCAGGCAGAGAATGTGGAGGG + Intergenic
1096235440 12:49923109-49923131 TTTGTTGAACTGAATCTGGAAGG - Intergenic
1096412416 12:51386913-51386935 TTTTGATCACAGAATGTGGGAGG + Intronic
1096997246 12:55846298-55846320 TTTTTTGTAGAGAGTGTGGGGGG + Intergenic
1097005251 12:55912046-55912068 TTTTTTGAAAATAATGTGCAAGG + Intronic
1097065484 12:56317389-56317411 TGTTTTGCAAAGAATGAAGAAGG + Exonic
1097507998 12:60500651-60500673 TTTCTTGCTCAGAATGTGTCAGG - Intergenic
1097655900 12:62363185-62363207 TTTTAAGAACAGATTGTGGAGGG - Intronic
1097966175 12:65583740-65583762 TTTTATGCCTAGAATGTGGTAGG - Intergenic
1100846920 12:98668749-98668771 TTTCCTGCAGAGAATGGGGATGG + Intronic
1101889999 12:108704736-108704758 TTTCTTGCACAGAATGTCTCAGG + Intronic
1102244845 12:111348918-111348940 TTTTTAGCACAGTTTCTGGAAGG - Exonic
1103762515 12:123261887-123261909 TTTTGTGGACAGGCTGTGGAAGG - Intronic
1104312447 12:127665768-127665790 TTTGTCTCTCAGAATGTGGATGG + Intergenic
1106387419 13:29301544-29301566 TTTCTATCACAGAATTTGGATGG + Intronic
1106405163 13:29466918-29466940 TATTTTCCACAGGATGTGGAAGG - Intronic
1106861800 13:33917575-33917597 TGCTTTGCCCAGCATGTGGAGGG - Intronic
1108784621 13:53881083-53881105 TTTTTTTCACAGAAGATGGTTGG - Intergenic
1108927147 13:55765983-55766005 TTATATGCATAGAATGTGTAAGG + Intergenic
1111400433 13:87726760-87726782 TATTTTGCTCAGAATGTGGCAGG - Intergenic
1111490881 13:88973304-88973326 TTTTTTGCCCAGATTTTTGAAGG - Intergenic
1111654239 13:91132187-91132209 ATTTTTCCACGGACTGTGGAGGG + Intergenic
1112103882 13:96219175-96219197 TTTTTTGAAAAGAAGGTGAAAGG - Intronic
1114064325 14:19048285-19048307 TTTTTTGCACAAAATACTGAAGG + Intergenic
1114097934 14:19351714-19351736 TTTTTTGCACAAAATACTGAAGG - Intergenic
1115909774 14:38242594-38242616 TGTTTTTCACAAAATGTGTAAGG + Intergenic
1116091399 14:40311368-40311390 TCTTTAGCAAAGACTGTGGAAGG + Intergenic
1118323010 14:64764287-64764309 TTTCTTGCATCGAAGGTGGATGG + Intronic
1119889000 14:78168571-78168593 ATTTGTCCACAGAATGTGGAAGG - Intergenic
1121983535 14:98476424-98476446 TTTGTTGGGGAGAATGTGGACGG + Intergenic
1125563122 15:40654484-40654506 TTTTTTCCACAGGAAGTTGAAGG - Intronic
1126080029 15:44951308-44951330 TTTTTTGCTTATAATGTGCATGG + Intergenic
1126182824 15:45802752-45802774 TTTTTTTAACAGAGTGTGGTAGG + Intergenic
1126406070 15:48323937-48323959 TTTATTGCTCAGAATATGGGAGG + Intergenic
1126589814 15:50327251-50327273 TTTTTTGAGCAGAATATTGATGG - Intronic
1126759175 15:51953669-51953691 CTTTTTACACAGAATTTGGAAGG + Intronic
1127050117 15:55073686-55073708 TTTTTAGTATAGAATGTGTATGG - Intergenic
1127157827 15:56148399-56148421 TTTTCTGTCCAGAATGTGAAAGG - Intronic
1128530039 15:68438717-68438739 TCTTTTGCACAGACTCTGGTAGG - Intergenic
1130082807 15:80749280-80749302 TTTTTTGCAAATGTTGTGGAAGG + Intronic
1130630220 15:85560317-85560339 TTTTTTGCAAAGAGTGGGGGTGG + Intronic
1133044087 16:3076541-3076563 CTTTTTGCACAGAAGTTTGAGGG - Intronic
1136739297 16:32500229-32500251 TTTTTTGTACATACTGTGAATGG + Intergenic
1136747472 16:32604386-32604408 TTTACTGCACAGAATTGGGAAGG + Intergenic
1137313893 16:47296333-47296355 TTTTTTGAACAGAATGAAAATGG - Intronic
1137906834 16:52331935-52331957 TTTTTTGCATAGAAAGTTAATGG + Intergenic
1137911578 16:52383298-52383320 GATTTTACACAGAATGTGCATGG + Intergenic
1138399228 16:56731825-56731847 TTTTTTGCACAGCAGCTAGAGGG + Intronic
1138951918 16:61922289-61922311 TTTTTTACACAAAATTTGCATGG - Intronic
1139488093 16:67270776-67270798 TTTTCTGCACAGGTTGGGGAGGG - Exonic
1140430914 16:74902283-74902305 TGTTCTGCACAGAAAGTGGGTGG - Intronic
1140583494 16:76258553-76258575 TTTGTTGAATAGAATGTGGTGGG + Intergenic
1141539229 16:84706023-84706045 TTTTTTTCAAAGAATGAGTAGGG - Intronic
1142281373 16:89149724-89149746 TTCTGGGCACAGAATGGGGAGGG + Intronic
1203013916 16_KI270728v1_random:331563-331585 TTTTTTGTACATACTGTGAATGG - Intergenic
1203032251 16_KI270728v1_random:604722-604744 TTTTTTGTACATACTGTGAATGG - Intergenic
1203049607 16_KI270728v1_random:863591-863613 TTTACTGCACAGAATTGGGAAGG + Intergenic
1142906563 17:3046849-3046871 TTATTTCCACAGAATTTTGAGGG + Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1150760861 17:67959678-67959700 TGTGTTGCACAGCAGGTGGAGGG - Exonic
1155984018 18:32210665-32210687 TATTCTGCAGACAATGTGGATGG + Exonic
1158095908 18:53770635-53770657 TTTTTTTCACAGAATTTTGGAGG - Intergenic
1158277552 18:55784757-55784779 TTTTTTTCAAAGTATGTGGCAGG + Intergenic
1161143130 19:2660611-2660633 TTTTTTGTACAGATGGTGGTGGG - Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1162300288 19:9841243-9841265 GTTCTTGCACAGAATCTTGAAGG + Intronic
1162673223 19:12276395-12276417 TCTTTTGCACAGTAGGTGGTAGG - Intronic
1164469904 19:28521544-28521566 TTTTTTACACAGAATGGTGATGG + Intergenic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
925126388 2:1460375-1460397 TTTTTTGCACAGATTCTGCTGGG - Intronic
925244995 2:2373987-2374009 TTATTTGCATAGAATGTTTATGG + Intergenic
925424299 2:3735956-3735978 TTTTTTGCAAATCTTGTGGAGGG + Intronic
926789279 2:16553937-16553959 TTTTTCCCACAGACTCTGGAAGG + Intronic
926870587 2:17411265-17411287 TTTTTTGAAAAGCATGGGGAAGG + Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927597344 2:24408245-24408267 GTTTTTCCACGGAATGGGGATGG + Intergenic
928793482 2:34987638-34987660 TTTAATGAACAGAATGTGGCAGG - Intergenic
929046010 2:37791266-37791288 GTTTTTGCTCAGAATTTTGAAGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
930591428 2:53331304-53331326 TTTTATGCACAGAATGGTGCTGG - Intergenic
930982721 2:57547218-57547240 TTTTTTGCAAACAATATGGTGGG - Intergenic
931040618 2:58294955-58294977 TATTGTGCACAGAGTGTGCATGG + Intergenic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
936006980 2:108897844-108897866 TGTTTTACACAGAATGTCCAGGG - Intronic
936868604 2:117107302-117107324 TTATAAGCACAGAATGGGGATGG - Intergenic
937078737 2:119125483-119125505 TTCTTTGCACAGGATGAGGGTGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938910757 2:135883822-135883844 TTAGTTGCACAGTATGTGGCAGG + Intergenic
938963169 2:136361259-136361281 TTTCTTCCACAGATTGTGGAAGG + Intergenic
939848495 2:147276580-147276602 TTTTTTCCACAGAAGGTAGTTGG + Intergenic
939902528 2:147867634-147867656 TTTCTAGCAAAGAGTGTGGAAGG - Intronic
940065657 2:149625137-149625159 TTTTCTGCTCATACTGTGGAAGG + Intergenic
940127298 2:150340926-150340948 TTTTTTGCAGAGAGTATTGATGG + Intergenic
941251385 2:163169054-163169076 TTTTATCCACAGAATGAGAAGGG - Intergenic
941808140 2:169730231-169730253 TTTTTGGCAAATAATTTGGAGGG - Intronic
942009400 2:171744265-171744287 TTTTTTCCAAAGAATGTAAAAGG + Intronic
943175271 2:184465133-184465155 ATTTTTGAAAAGAAGGTGGAAGG + Intergenic
943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG + Intronic
944688431 2:202137975-202137997 CTTTTTCCTCATAATGTGGAGGG - Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946110494 2:217410983-217411005 TTTTTTGGCCAGAGTGTGGCAGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
946911026 2:224460889-224460911 TTTTTTCAACCAAATGTGGATGG - Intergenic
1168910533 20:1443386-1443408 TTTTATGCAGAGAAGATGGAAGG + Exonic
1170472866 20:16685690-16685712 CTTTTTGCGCATAATATGGATGG - Intergenic
1170685323 20:18564428-18564450 GTTTTTCCACAGAATGTAGGGGG + Intergenic
1170691318 20:18618251-18618273 TTTAATGCACAGAGTGTGGTTGG + Intronic
1172966911 20:38842425-38842447 TTTTTCTCTCAGAATGTGTAGGG + Intronic
1174094004 20:48073503-48073525 TTTTTGGCACATAACCTGGAAGG - Intergenic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1175495210 20:59409652-59409674 CTTTTTCCCCAGACTGTGGAGGG - Intergenic
1176047465 20:63100369-63100391 TTGTTTTAACAGAATGGGGAGGG + Intergenic
1177131124 21:17256996-17257018 TTTTTTGCACAGAATGGGAGAGG + Intergenic
1177642561 21:23862333-23862355 TTTTCTTCAGAAAATGTGGAAGG + Intergenic
1179036654 21:37763789-37763811 TAGTTTGCTCAGAATGTGGGGGG + Intronic
1180482816 22:15770911-15770933 TTTTTTGCACAAAATACTGAAGG + Intergenic
1180902146 22:19381982-19382004 AAATTTGCACAGAAAGTGGATGG - Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1181423965 22:22820851-22820873 TTTTTTACACAGGATGTGGAGGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
1184024311 22:41843391-41843413 TTGTTCTCACAGAATGTGTATGG + Intronic
1184537984 22:45100379-45100401 TTTTGTCCTGAGAATGTGGAAGG + Intergenic
1185098649 22:48825797-48825819 TTTTCTGCACAGAAACTGGGAGG - Intronic
949434568 3:4014473-4014495 TTTTTCAAACAGAATGTGGTTGG + Intronic
949546841 3:5080060-5080082 TTTTTTAAACAAAATGGGGATGG - Intergenic
949870043 3:8580641-8580663 TTGTTTGGACAGAGTGTGGGTGG - Intergenic
950135508 3:10577892-10577914 TTTTCTGCACAGGAAGTGGATGG - Intronic
950262320 3:11552075-11552097 TTGTTTGCACTGCATGTGGTGGG + Intronic
951355411 3:21661025-21661047 AATATTTCACAGAATGTGGATGG + Intronic
951558088 3:23941485-23941507 TATTTTGGTCAGAATGAGGAAGG + Intronic
952579866 3:34820481-34820503 TTTTTTACACAGAAAGTCAAAGG - Intergenic
953669554 3:44951295-44951317 CTCTGTGCAGAGAATGTGGAAGG - Intronic
954746566 3:52790818-52790840 TGTTTTGCACCGAGTGTGGAAGG + Exonic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
956091052 3:65667455-65667477 TGTTTTGCACAGACTGGGGAAGG + Intronic
957585167 3:82123656-82123678 TTGTTTGCAAAGAAAGGGGAAGG - Intergenic
957698204 3:83671964-83671986 TATTTTGTACAGAATTTGGCAGG + Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
961842148 3:129723675-129723697 CTATTTGGACAGAATGTAGAGGG - Intronic
961954657 3:130789063-130789085 GTTATTGCACAGAAAATGGAGGG - Intergenic
963185593 3:142412403-142412425 TTTTATGCACATAATGAAGAGGG + Intronic
964251383 3:154721895-154721917 TTTATTACACAGAATAAGGAAGG - Intergenic
964331507 3:155608310-155608332 TTTCTTGAGCAGAATCTGGAGGG + Intronic
964365887 3:155950563-155950585 TTTTTTCAACCAAATGTGGATGG + Intergenic
964547094 3:157846368-157846390 TTTTTTCCAAAGGATGGGGAAGG - Intergenic
965012826 3:163117298-163117320 TTTTTTGAACAAAATCTGGTTGG - Intergenic
965329169 3:167348676-167348698 TCTTTTGCACAGAACATGTATGG - Intronic
965789851 3:172375560-172375582 TTTTGTTCTCAGAATGTGTATGG - Intronic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
967631855 3:191753170-191753192 TTTTTTGGAGAGAATATGGCAGG - Intergenic
968677035 4:1888519-1888541 TTTTTTCCTCAGAATTTTGAAGG + Intronic
969213851 4:5708179-5708201 TATTTCGCAAAGAATGAGGAAGG - Intronic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
970181407 4:13399944-13399966 TTTTCTACTTAGAATGTGGAAGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
971781144 4:31036080-31036102 TGTTTTACACAAAATGTGAAGGG + Intronic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
974163882 4:58175038-58175060 TTTTTTGCAAACAATGTGAGAGG - Intergenic
974353951 4:60788059-60788081 TTTATTGCACAAAATGCTGAGGG - Intergenic
975545600 4:75557239-75557261 CTTTTTGCAGAGAAAGTGGCAGG - Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
976531206 4:86154240-86154262 CTTTAAGCACAGAATATGGATGG - Intronic
977242589 4:94591254-94591276 TATTTTGGAAAGAATGTGCAAGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
978712302 4:111799057-111799079 TTCTATGCACAGAGTGGGGAGGG + Intergenic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
980026762 4:127777497-127777519 TTTTTTGCACAAATTGGGGGAGG + Intergenic
980088843 4:128420623-128420645 TTTTTTGCACAGCACATAGAAGG - Intergenic
980726320 4:136766177-136766199 TTTTTTCCAATGAAAGTGGAGGG - Intergenic
981351587 4:143736054-143736076 TTTTTTGCAGCTATTGTGGAAGG + Intergenic
981819112 4:148866016-148866038 TATTTTTCTCAGAATATGGATGG - Intergenic
981913870 4:150012946-150012968 TATCTTACACTGAATGTGGATGG - Intergenic
982032599 4:151315549-151315571 TATTTTGGACAGAATTAGGATGG + Intronic
983139078 4:164125916-164125938 GTTTTTCCACAGAATGGGGCAGG - Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
985213453 4:187621207-187621229 TATTGTGCACTGACTGTGGAAGG + Intergenic
986117879 5:4798006-4798028 TTTTTTTCATTGAATGTGAAAGG + Intergenic
986616428 5:9621985-9622007 TTTTTTGAACAGAAGGTGCTTGG - Intergenic
986798615 5:11236811-11236833 TTTTGTTCAGAGAATTTGGATGG - Exonic
987588099 5:19885083-19885105 TTTTTCGCCCATAATATGGAAGG - Intronic
988069369 5:26267014-26267036 TTTTCTGCACAGGATGAGTAGGG + Intergenic
988645149 5:33086800-33086822 TTTTTTTCACAGTTTTTGGATGG - Intergenic
989630994 5:43482975-43482997 GTTTTTGCATATAATGTGTAAGG - Intronic
990257607 5:53987378-53987400 TTTTCTGCAAATTATGTGGAAGG - Intronic
994208278 5:97060090-97060112 TTTCTTGAACAGAATCTGGGGGG - Intergenic
994766491 5:103924425-103924447 TTTTATGCACAGAACTTGGTCGG + Intergenic
994796424 5:104306575-104306597 GTTTTTGCACAGAATATAGAGGG - Intergenic
995043433 5:107616535-107616557 TTTTTTAAAAAGAATGTGCATGG - Intronic
995863525 5:116665825-116665847 TTTCTTGCTCAAAATGGGGAGGG - Intergenic
996011463 5:118485374-118485396 TTTTTTGCACTTATTGTGAAAGG - Intergenic
996182681 5:120438810-120438832 ATTTTTCCTCAGAATTTGGATGG - Intergenic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
996369954 5:122742557-122742579 TTTTTTGCGCAATATTTGGAGGG - Intergenic
996658099 5:125965895-125965917 TTTTTAGAAAAGGATGTGGATGG - Intergenic
997029468 5:130108391-130108413 TACTTTGCACAGACTCTGGATGG - Intronic
997391750 5:133522940-133522962 GTGTTTCCACAGAATGTGTAAGG + Intronic
998903997 5:146884207-146884229 TTTATTGTACAGAAATTGGAGGG - Intronic
999463199 5:151774369-151774391 TATTTTGCATAGAAAGTGAACGG + Intronic
999532114 5:152475370-152475392 TTTTTTGTACAGAATGCTGAGGG - Intergenic
999962176 5:156767620-156767642 ATTTTTGCATAGAGTGTGCAAGG - Intronic
1000219153 5:159195292-159195314 TTTGTTTCAAAGAATGTGCAGGG + Intronic
1000428410 5:161120072-161120094 TTTTTTGCACAGCCTCTGGAGGG - Intergenic
1000913448 5:167050400-167050422 TTTTTTTCACAGACTGGGGTTGG - Intergenic
1000962662 5:167618688-167618710 TTTATTGCAAAGAAGGTTGATGG - Intronic
1001464858 5:171954759-171954781 TTTTTTCTACAGAATTTGGCAGG + Intronic
1003779928 6:9413157-9413179 TTCTTTGGGCAGAATGTGAATGG + Intergenic
1005134800 6:22555772-22555794 TTTTTTTAAAAGAATATGGATGG + Intergenic
1005678784 6:28183999-28184021 TTTTTTGCAAATGATGTGTATGG - Intergenic
1006990472 6:38210988-38211010 CCTTTTGCCCAGAATGGGGAAGG - Intronic
1008167906 6:48163368-48163390 TTCTTTGCAAAGAGGGTGGAAGG - Intergenic
1008692840 6:54000251-54000273 TGTTTTGCTCAGAGAGTGGATGG + Intronic
1009848376 6:69163487-69163509 TTTTTTTCACATAATTTGAATGG - Intronic
1009960114 6:70509540-70509562 TTTTTCCCACAGAATGTTTATGG + Intronic
1011010534 6:82698668-82698690 TTTTTTTCACATAATTTGGTAGG + Intergenic
1011154431 6:84314231-84314253 TTCTTTGCATAGAAGTTGGATGG + Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1012781940 6:103571623-103571645 TTTTTTGTACAGAATTTGTAAGG + Intergenic
1012873623 6:104699951-104699973 TTTTTTCCACACAATAAGGAGGG - Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013471353 6:110469099-110469121 TCTATTGCACAGATTGTAGATGG + Intronic
1014052631 6:116973551-116973573 TTTTTGGCATAGTGTGTGGATGG - Intergenic
1014302346 6:119697931-119697953 TTTTTGGCACATAACTTGGAAGG - Intergenic
1016449069 6:144162491-144162513 TATTTTATCCAGAATGTGGAAGG + Intronic
1016776773 6:147913192-147913214 TTTTTTGCACTGATTGTGGTTGG - Intergenic
1016958092 6:149646083-149646105 TTTTTTTAACATAATGTGCATGG + Intronic
1017758502 6:157549771-157549793 GTTTTTCCACAGGATTTGGAAGG + Intronic
1018375362 6:163205531-163205553 TTTTGTGCACAGTATAAGGAAGG - Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1018496912 6:164357780-164357802 TTTTTAGCTAAGAATCTGGATGG - Intergenic
1019453477 7:1112211-1112233 TCTTTGGCCCAGAATGAGGATGG + Intronic
1019845602 7:3496973-3496995 TTCTGTGCCGAGAATGTGGAGGG - Intronic
1021443046 7:20701080-20701102 CTTTTTGCACAGAAGGTGTAAGG - Intronic
1022171139 7:27832966-27832988 TCTTCTCCACAGAATGTGAATGG - Exonic
1022632329 7:32097038-32097060 TTTTCTGGACTGGATGTGGATGG - Intronic
1023262247 7:38369882-38369904 AATATTACACAGAATGTGGAGGG + Intergenic
1025550875 7:62247185-62247207 TTTTTTGTACATACTGTGAATGG + Intergenic
1025598456 7:62962751-62962773 TTTTTTGTAGAAACTGTGGAAGG + Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026072425 7:67133941-67133963 TATTTTCCACAGGATGAGGAGGG - Intronic
1026704474 7:72678297-72678319 TATTTTCCACAGGATGAGGAGGG + Intronic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1028363863 7:90004059-90004081 TTTATGGCACAGAATATGTATGG + Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1028835847 7:95374097-95374119 TTTTTTCCACAGATCATGGAGGG - Intronic
1029591596 7:101510683-101510705 TTTTTTGTAGAGAATGAGGCTGG + Intronic
1030313229 7:108088808-108088830 TCTCTTGCACAGAAGGTGTATGG + Intronic
1030399061 7:109025975-109025997 TCTTTTCCACAGAATGATGAAGG + Intergenic
1030692337 7:112548064-112548086 TTTTTTGTAGAGACTGTGGGTGG - Intergenic
1030969485 7:116037196-116037218 TTTTGTGCACGGGATGTTGAGGG + Intronic
1031631824 7:124052625-124052647 TTTCTTGCATAGTATGTAGAAGG + Intergenic
1032103593 7:129004911-129004933 ATTTTTGCACAGTAACTGGAAGG - Intronic
1032137761 7:129296818-129296840 TATTTTTCACATAATCTGGAAGG + Intronic
1032351198 7:131165496-131165518 TGTTTTACACAGAAGGTGTAGGG + Intronic
1032506396 7:132437857-132437879 TGTTTTCCACTTAATGTGGAGGG - Intronic
1032860981 7:135879025-135879047 TTTTTTGCCCAGTATGAAGATGG + Intergenic
1033004488 7:137546573-137546595 TTTTCTACCCAGAATGTGGGTGG - Intronic
1033174723 7:139113547-139113569 TTCATGGCACAGAAAGTGGAGGG - Intergenic
1033537024 7:142321560-142321582 GTTTGTGCACAGAATGTGGTTGG - Intergenic
1033876746 7:145829396-145829418 TTTTTTGTTGAGATTGTGGAGGG - Intergenic
1034178966 7:149123262-149123284 TTTATAGCACAGAATCTGAAAGG - Intronic
1034391578 7:150791613-150791635 TTTTTTTTCCAGAATGAGGAAGG - Exonic
1034862916 7:154615477-154615499 TTTTTTCCACAAAAACTGGAGGG - Intronic
1038235054 8:25745172-25745194 TTATTTGCAGAGCATGTGAATGG - Intergenic
1038387537 8:27163321-27163343 TTTTTTGGAAAAAATGTGCATGG - Intergenic
1038719469 8:30021065-30021087 TTTTTTCCAAAGACTGTGGAAGG + Intergenic
1039008399 8:33066623-33066645 TTTTCTGCAAAGAATGTCAATGG - Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG + Intronic
1039753985 8:40503148-40503170 TTTTTTTCACAGACTATGCAAGG + Intergenic
1040114215 8:43596498-43596520 ATTTTTGCAGAAAATGTGAAGGG + Intergenic
1040297247 8:46160616-46160638 TTTTTTGCAGAAAATGTGAAGGG - Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042277051 8:67016567-67016589 TTTTTTGCACAGAATTTAACTGG - Intronic
1042435015 8:68754001-68754023 GTACTTGCACAGAATGTGGGAGG - Intronic
1044362342 8:91302261-91302283 TTTTTTGCACTGACTGAGAAAGG + Intronic
1044407313 8:91843046-91843068 TTTTTTGCATTTAATGTTGATGG - Intergenic
1045773520 8:105774116-105774138 TTTTCTGCATAGATTATGGAAGG - Intronic
1046124382 8:109885863-109885885 TTGTTTGCACAGTACTTGGAGGG - Intergenic
1046150811 8:110222197-110222219 TTCTTTGTTCAGAATGTTGAAGG + Intergenic
1046679205 8:117149965-117149987 TCATGTGCACAGAATGTGGGAGG + Intronic
1047594488 8:126364672-126364694 TTTTTTGCAGGGACTGGGGAGGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048794898 8:138140965-138140987 TTTTTTTCACAGAAATTTGAAGG + Intronic
1051100750 9:13518292-13518314 TTTTTTCCTCTGACTGTGGAAGG - Intergenic
1051319248 9:15882900-15882922 TTTTTAGGACAGAATCTTGAGGG + Intronic
1051761173 9:20466359-20466381 TTTTTTTCACATAATGTTAAGGG - Intronic
1052031035 9:23629268-23629290 TTATTAGCACAGCATGTTGAAGG + Intergenic
1052276958 9:26687546-26687568 TTCTTTTCACAGCATGTGGCAGG + Intergenic
1052544492 9:29857540-29857562 TTTTTTACACAGAATGGAAAAGG + Intergenic
1053551795 9:39088058-39088080 TATTTTGCTTAGAATGAGGAGGG + Intronic
1053815926 9:41908193-41908215 TATTTTGCTTAGAATGAGGAGGG + Intronic
1054614671 9:67279248-67279270 TATTTTGCTTAGAATGAGGAGGG - Intergenic
1054972336 9:71102997-71103019 GTTTTTGAACAGAATTTGGAGGG + Intronic
1056681421 9:88722310-88722332 TTATTTCCACAAGATGTGGAAGG + Intergenic
1057423155 9:94928058-94928080 CTTTCTGCACAGGATGGGGAAGG - Intronic
1059647113 9:116278660-116278682 TTTTTAGCATAGAATGTGTTTGG + Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061836070 9:133331250-133331272 TTTACTGCTCAGAATTTGGAGGG - Exonic
1186872466 X:13786027-13786049 TAATTTGCTCAGAATCTGGAAGG + Intronic
1188597273 X:31916788-31916810 TATATTGCACAGAAAGAGGAAGG + Intronic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1191025315 X:55907920-55907942 TTTTTTGACTAGAATGGGGAAGG - Intergenic
1191245043 X:58221371-58221393 TTTTTTGTAGAAAATGTGAAGGG + Intergenic
1192771674 X:74199026-74199048 TTTTTTTCAAACGATGTGGAAGG - Intergenic
1192934158 X:75840879-75840901 TTTTTTATACAGTATATGGAAGG + Intergenic
1193932878 X:87578772-87578794 TTTTTTGCACAGAGTGCTAAAGG + Intronic
1194747335 X:97642367-97642389 CTTTTAGCACAGCATCTGGAAGG - Intergenic
1195772298 X:108364253-108364275 TTTCTTGAATAGATTGTGGAAGG - Intronic
1196142374 X:112277886-112277908 TTTTCTGAACAGAATCTAGAAGG - Intergenic
1197341233 X:125268016-125268038 TTGTATGCACAGAAGGTGGTAGG - Intergenic
1197671940 X:129286511-129286533 TTTTTTGCAGAGAGTAGGGATGG + Intergenic
1197890883 X:131269047-131269069 TTTTTTGTAAGGAATGTGAATGG + Intergenic
1199013445 X:142783724-142783746 TTCTCTGGAAAGAATGTGGATGG + Intergenic
1199912475 X:152302273-152302295 TTTTGTACACAGAATGTGGTTGG - Intronic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic