ID: 1181417239

View in Genome Browser
Species Human (GRCh38)
Location 22:22769388-22769410
Sequence GAACACATGTGGCAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181417239 Original CRISPR GAACACATGTGGCAGGAACC AGG Intronic
901438267 1:9262621-9262643 GACCCTATGAGGCAGGAACCAGG - Intronic
901679339 1:10904128-10904150 GAACAAATGGGGCAGGCAGCTGG - Intergenic
901807784 1:11748997-11749019 GACCCCATGTGGCAGGAAATGGG - Intronic
901923486 1:12552094-12552116 AAACACAGGTGGCAGGGGCCAGG + Intergenic
903418727 1:23202885-23202907 GAATACATGTGGGAAGAATCTGG + Intergenic
903517636 1:23922723-23922745 GGACACTTGTGCCAGGTACCGGG - Intergenic
904420851 1:30390268-30390290 TAACACATGTGGCAGGGAGAGGG + Intergenic
905522478 1:38610990-38611012 GTAGAAATGTGGCAGGAACTGGG + Intergenic
905707503 1:40072319-40072341 GAAGACAGGTGACAGGCACCTGG - Exonic
905776898 1:40673856-40673878 TCACACATGTGGAAGGAAACAGG - Intergenic
906391583 1:45421783-45421805 GAACACATTGAGCAGTAACCGGG - Exonic
906739268 1:48165804-48165826 GGACACATGTGGAGGGATCCAGG - Intergenic
910047996 1:82940546-82940568 GAACACAGGTGGCAGGTATTAGG - Intergenic
913160299 1:116139226-116139248 GAACACATATGAAAGGAGCCAGG + Intergenic
915418688 1:155762403-155762425 GAACACAGGTTGCAGGGACAGGG - Intronic
915713469 1:157922878-157922900 GAGCACCTGTGGCCAGAACCAGG - Intergenic
917145448 1:171885691-171885713 TAACCCATGTAGCAGGAAACTGG + Intronic
917366039 1:174233053-174233075 GAACACATGAACCAGGAAGCAGG - Intronic
917444232 1:175093226-175093248 GAACACATGAAGCAGGACCTTGG + Intronic
917816484 1:178715085-178715107 GAAAACAAATGGCAGGAACAGGG - Intergenic
918117226 1:181507913-181507935 GAACACTTTTGTTAGGAACCAGG + Intronic
921536708 1:216358778-216358800 GAAAACATGTAACAGGAAACCGG - Intronic
921626770 1:217385892-217385914 AAACAGATGTGGCAGCAACATGG + Intergenic
922460688 1:225812506-225812528 TAAGACATCAGGCAGGAACCAGG - Intronic
922739708 1:228008182-228008204 GAACACAAGTGGGAGGAATGTGG + Intronic
924770470 1:247075506-247075528 TCCCACATGTGGCAGGAACGTGG + Intronic
1063895806 10:10680403-10680425 GGGCACATGGGGCAGGATCCAGG + Intergenic
1064229069 10:13513827-13513849 GGAGAAATGTGGCAGGAGCCAGG - Intronic
1064345680 10:14530913-14530935 GGACACATGTGTCAGGAAAGAGG + Intronic
1065112924 10:22457758-22457780 AAACACATGGAGCAGGAATCAGG - Intergenic
1069785952 10:70988025-70988047 GAAAAGATGTGGCAGACACCCGG - Intergenic
1070498477 10:77047564-77047586 TTACATATGTGGCAGGAAACTGG + Intronic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1070827455 10:79399480-79399502 GATCACATCTGCCAGGAGCCTGG + Intronic
1071602974 10:86967943-86967965 AAACGCATGTGGCAGGGACTTGG - Intronic
1073619712 10:105034382-105034404 GAACCAATGTGGCTGGAACTTGG + Intronic
1076555315 10:131317651-131317673 GCACATGTGTGGCAGGACCCTGG - Intergenic
1076728871 10:132428559-132428581 GACCAGATGTGGCCGGGACCTGG + Intergenic
1078157848 11:8814034-8814056 GCATACATGTGCCAGAAACCTGG + Intronic
1078360567 11:10664567-10664589 GAACTCATGGGGCAGAAAGCAGG - Intronic
1080165534 11:29231903-29231925 GCACAGATGTGGCATGAAGCAGG - Intergenic
1080837551 11:35953904-35953926 GAGCCCAGCTGGCAGGAACCTGG + Intronic
1087671548 11:101112947-101112969 GAACACATATGTCAGGAACTTGG - Intronic
1093636657 12:21479147-21479169 GAACAATTGTGGGAGGAACTGGG - Intronic
1093977547 12:25439469-25439491 GAAGACCTGTGTCAGAAACCAGG - Intronic
1097190060 12:57215365-57215387 GAAGCCAGGAGGCAGGAACCTGG - Intergenic
1097258155 12:57696247-57696269 GAAGACATGAGGCAGGAATGGGG - Intronic
1097755519 12:63402929-63402951 AAACACATCTGGCAGGAAAGGGG - Intergenic
1101891337 12:108718272-108718294 GAACCCAGGAGGCATGAACCTGG + Intronic
1106682179 13:32019288-32019310 GAAAAAAAGTGGCAGGGACCTGG - Intergenic
1112376433 13:98846053-98846075 TCACTCATGTTGCAGGAACCAGG - Intronic
1113865114 13:113516825-113516847 GAACAGAGGAGGCAGGCACCTGG + Intronic
1114222307 14:20707753-20707775 GAAGGTCTGTGGCAGGAACCAGG - Intergenic
1115470716 14:33765897-33765919 GAACTTTTGGGGCAGGAACCTGG + Intronic
1115568649 14:34647042-34647064 GAACTCATGTGGCAGGTGGCAGG - Intergenic
1120748710 14:88177477-88177499 GAATAGACGTGGCAGGAACTTGG - Intergenic
1122097290 14:99381226-99381248 GCAGACAGGTGGGAGGAACCAGG - Intergenic
1122420353 14:101572555-101572577 GTACACATGGAGCAGGAGCCTGG - Intergenic
1122420377 14:101572711-101572733 GTACACATGGAGCAGGAGCCTGG - Intergenic
1123895766 15:24828451-24828473 AAACATATGTGGCTTGAACCCGG + Intronic
1124200258 15:27673341-27673363 GAAGACATGTTGCAGCAAACAGG - Intergenic
1124624131 15:31298582-31298604 GAAGCCATGTGGCAGGAAAGAGG + Intergenic
1126090565 15:45047725-45047747 GAAGCCATGTGGCAGGAGCCAGG - Intronic
1126328966 15:47511513-47511535 TAACACATGTGGCAGGAGGGGGG - Intronic
1126581123 15:50243434-50243456 GATCCCATGTGACAGGAAACAGG - Intronic
1128568448 15:68716367-68716389 GACCACATGTGCAAGGCACCTGG + Intronic
1128694350 15:69749238-69749260 GGTTACAAGTGGCAGGAACCTGG + Intergenic
1130572699 15:85062639-85062661 GAACACAACTTGCAGGACCCAGG - Intronic
1130724619 15:86426096-86426118 GAACACATGTAGTAGAAAACAGG + Intronic
1132458730 16:38839-38861 GAACAGAGGTGTCAGGAGCCAGG - Intergenic
1134199973 16:12190173-12190195 GACCACATCTGGAAGGACCCTGG + Intronic
1134787849 16:16961207-16961229 AAACACATCTGTCAGGACCCAGG - Intergenic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1138913143 16:61427566-61427588 GAACATATGAGGCAGAAGCCAGG + Intergenic
1139176202 16:64691223-64691245 GAAAGCATGTGGCAGGATCCAGG + Intergenic
1139640132 16:68285612-68285634 GAACACAGGTGGCAGGTGCCAGG - Intronic
1140410628 16:74738544-74738566 GAACAAATGTGGCAGCCATCAGG - Intronic
1140867265 16:79074200-79074222 GCAAATATGTGGAAGGAACCTGG + Intronic
1142885999 17:2912369-2912391 GAAGACAGGAGGCAGGAACCAGG - Intronic
1143197773 17:5089261-5089283 GATCACAGCTGGAAGGAACCTGG - Intronic
1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG + Intronic
1143949048 17:10618497-10618519 GAACAGATGAGGCAGGAGCAGGG + Intergenic
1148991425 17:51669910-51669932 TCCCACATGTGGGAGGAACCTGG + Intronic
1150430544 17:65112268-65112290 GGAGCCATGTGCCAGGAACCAGG + Intergenic
1151442104 17:74136109-74136131 GCAGACATGTGACTGGAACCAGG + Intergenic
1157201619 18:45664442-45664464 GAGAACATGTGGCAGCAAACAGG + Intronic
1157227665 18:45881724-45881746 GAACAGAAGTGGCAGGAATGTGG + Intronic
1158559244 18:58499698-58499720 GAGCACAGGAGGCAGGACCCAGG - Intronic
1167513080 19:49907087-49907109 TAACAAATGTGACAGGGACCGGG + Intronic
1167681195 19:50922542-50922564 GAGCAGAGGTGGCAGGAAGCAGG + Intergenic
1167818260 19:51903472-51903494 GGAGACATGTGCCAGGAAACAGG + Intronic
926231134 2:11005133-11005155 GAACAGAAGAGGCAGGAACTAGG + Intergenic
926385355 2:12330463-12330485 GAAGAAATGTGGAAAGAACCTGG - Intergenic
927494395 2:23542817-23542839 GGACACCTGGGGAAGGAACCAGG + Intronic
929282194 2:40092511-40092533 TAAAACATGTTGCAGGAACATGG + Intergenic
930059260 2:47274743-47274765 GAGCACCTGTGGCAGCAGCCTGG + Intergenic
930664089 2:54084806-54084828 GGACACAGGTGGCAGGAAGAGGG - Intronic
932080433 2:68709521-68709543 GCTCACATTTGGCAGGAAGCTGG + Intronic
933150349 2:78907195-78907217 GGAGACATGTTTCAGGAACCAGG - Intergenic
933327381 2:80855370-80855392 AAGCACATGGGGCAGGATCCAGG - Intergenic
933390700 2:81663061-81663083 GAACACATTTGGGAGCAACAGGG - Intergenic
935790527 2:106585866-106585888 GAACAGAGGTGGAAGGAGCCAGG - Intergenic
944300386 2:198117618-198117640 CCACACATGTTGCAGGAAACAGG + Intronic
948467741 2:238160231-238160253 GACCCCTTGTGGCTGGAACCAGG + Intronic
1169344889 20:4822232-4822254 GATCAACTGTGGCAGGAACTGGG + Intronic
1169722890 20:8698621-8698643 GAACACATGTTGTAGGGAGCTGG + Intronic
1172446205 20:34994713-34994735 GAACCCAGGTGGCAGGTAACAGG + Intronic
1175224604 20:57437672-57437694 GCAGAAATGTGGAAGGAACCTGG - Intergenic
1175333642 20:58180962-58180984 GAACACAGCTGGCCGGCACCTGG + Intergenic
1177572101 21:22900618-22900640 GACCACATGAGTCAGGAATCTGG + Intergenic
1178887214 21:36493785-36493807 GAACACATGTGGCTGGAGGAAGG + Intronic
1181417239 22:22769388-22769410 GAACACATGTGGCAGGAACCAGG + Intronic
1183042149 22:35190133-35190155 GAAGAGATGAGGCAGGAACACGG + Intergenic
1183899058 22:40991415-40991437 GAAGGCATGTGGCTGGAACCAGG - Intergenic
1183971188 22:41478742-41478764 GAAGATATGTGGCAGGGACAGGG - Intronic
1184769699 22:46589962-46589984 CAATACATGCCGCAGGAACCAGG - Intronic
1184985937 22:48134133-48134155 GATAACATGTGGCAGAAACCTGG - Intergenic
956644672 3:71444223-71444245 GAACACATCTGGAGGGAGCCAGG + Intronic
957146959 3:76436349-76436371 GAAGACAGGTGACAGGTACCTGG - Intronic
961326973 3:126114714-126114736 GACCCCAGGTGGCAGGGACCTGG + Intronic
963042869 3:141082131-141082153 GCACACATGTGTCAGGGACAAGG - Intronic
964149199 3:153503674-153503696 GAGCTCAAGTGGCAGGATCCAGG + Intergenic
965382660 3:168009583-168009605 AAACTCATGTGGCAGTATCCTGG - Exonic
965951850 3:174318491-174318513 GCACACATCTTGCAGGAGCCAGG + Intergenic
968486971 4:867535-867557 GAACACACGTGGCCAGCACCAGG + Intronic
968486993 4:867606-867628 GAACACACGTGGCCAGCACCAGG + Intronic
970857429 4:20665216-20665238 CAGCACATGTGGTAGGGACCAGG - Intergenic
971397133 4:26238963-26238985 GAAAACACTTGGCAGGAACAGGG + Intronic
972646471 4:40972599-40972621 ATGCACATGTGCCAGGAACCAGG + Intronic
973970259 4:56206296-56206318 GACCACATGAGTGAGGAACCTGG - Intronic
975716033 4:77206532-77206554 TAACACCTGTGCAAGGAACCAGG + Intronic
980192814 4:129546164-129546186 GAAAAGGTGTGGCAGGAAACAGG + Intergenic
980423531 4:132594677-132594699 GAAAACATGTGGCAGGTAAGTGG + Intergenic
984382115 4:179007876-179007898 GAACAAATGAGGCTGGAACCTGG - Intergenic
986560245 5:9053578-9053600 GAAGACATGTGGCTGCACCCAGG + Intronic
986907729 5:12515983-12516005 CCCCACATGTGGGAGGAACCTGG + Intergenic
991411940 5:66354295-66354317 GAACCTCTGTGTCAGGAACCTGG + Intergenic
993333756 5:86632024-86632046 GAGCTTATGTGGCATGAACCAGG - Intergenic
995017351 5:107326024-107326046 GTATACATGTGGGAGGAACTAGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001703583 5:173724844-173724866 AAGCTCATGTGTCAGGAACCAGG + Intergenic
1001877051 5:175210674-175210696 GAACCCAGGTGCCAGGACCCAGG + Intergenic
1002561142 5:180083133-180083155 GACCCCATGTGGCAGGAAGAAGG - Intergenic
1002682276 5:180975843-180975865 ACACACCTGTGGCAGGAACTGGG + Intergenic
1003405059 6:5821245-5821267 GAACACAGGTGGGAGGAACAAGG - Intergenic
1004546859 6:16606320-16606342 GAACACATGTGATGGGTACCTGG + Intronic
1006372816 6:33655916-33655938 GTGCACATGTACCAGGAACCTGG + Intronic
1007207038 6:40161162-40161184 CAAGAAATGTGGCAGGATCCAGG + Intergenic
1009950993 6:70395391-70395413 GCACACATGAGGCAGGGTCCAGG - Intergenic
1012709831 6:102584920-102584942 GAAGCTATGTGTCAGGAACCAGG + Intergenic
1013733815 6:113203301-113203323 GCACTCATGTTGCAGGCACCAGG - Intergenic
1014779788 6:125550968-125550990 GATCACATCTGGCTGGAAACTGG + Intergenic
1017955764 6:159176567-159176589 GAAGTCATGTGCAAGGAACCAGG + Intronic
1018943829 6:168330895-168330917 TAACACACATGGCAGGAAACTGG - Intergenic
1019179006 6:170175716-170175738 GACCCCATTTGGCAGGAACGTGG + Intergenic
1022485680 7:30775772-30775794 GAATCTATGTGCCAGGAACCTGG + Intronic
1024213527 7:47227562-47227584 GAGGACATCTGGCAGGATCCTGG - Intergenic
1028010323 7:85634831-85634853 GAAGCCCTGTGACAGGAACCAGG - Intergenic
1028408753 7:90505052-90505074 AAACACATGTGGCAGGGAGAGGG + Intronic
1029021869 7:97372660-97372682 GAACAAATGTGGTATGAACATGG - Intergenic
1029339090 7:99928701-99928723 GAACACATCTGCCTAGAACCTGG + Intronic
1033396389 7:140977995-140978017 AAAGTCATGTGGCAGGAACTAGG + Intergenic
1034254920 7:149719690-149719712 CAGCACGTGTGGCAGGAGCCTGG + Intronic
1035385003 7:158465765-158465787 GCACACATGTGGCAGGTAGCTGG - Intronic
1035915549 8:3617696-3617718 GAAAAGATGTGTCAAGAACCTGG + Intronic
1036106615 8:5847258-5847280 CCCCACATGTGGAAGGAACCAGG - Intergenic
1038928135 8:32163197-32163219 AGACCCATGTGGCAGGAACTTGG + Intronic
1041045576 8:53882876-53882898 GGACACAAGTGGCAGGGCCCTGG + Intronic
1041662435 8:60413076-60413098 GAAGACTCGGGGCAGGAACCAGG + Intergenic
1044930610 8:97248405-97248427 AAAAACATGGGCCAGGAACCAGG + Intergenic
1045055432 8:98364275-98364297 GCACAGATGTGGAAGGAAGCGGG - Intergenic
1045338797 8:101233454-101233476 GAAAAGAGCTGGCAGGAACCAGG + Intergenic
1045755362 8:105534688-105534710 AAATACATGTGGCTGAAACCAGG + Intronic
1048786864 8:138059870-138059892 AAAATCATGTGGCAGGAGCCAGG - Intergenic
1053225553 9:36352741-36352763 CAACACATATGGCAGTAAGCTGG + Exonic
1055883681 9:81033259-81033281 TGACACATGTGGCAGGAAGGAGG + Intergenic
1057308220 9:93924840-93924862 GAGCACATGGGGCAGGCTCCAGG + Intergenic
1062409170 9:136413637-136413659 AAACACACCAGGCAGGAACCTGG - Intronic
1186665603 X:11713778-11713800 AAAGACATGATGCAGGAACCAGG - Intergenic
1189145437 X:38650480-38650502 GAAGACATGTGGTAAGAGCCAGG + Intronic
1189759416 X:44306027-44306049 GACCCCATATGGCAGGATCCAGG + Intronic
1191168460 X:57417625-57417647 GGACACATGTGGCTGGCATCTGG - Intronic
1192180182 X:68911372-68911394 GAACACATGGTCCAGGACCCAGG - Intergenic
1197013117 X:121591257-121591279 CAACCCATGAGGTAGGAACCAGG - Intergenic
1200939727 Y:8768984-8769006 GAACACAGGTGGAAGGCACCTGG + Intergenic
1201618225 Y:15925491-15925513 GAAGACATGTGACAGCAACCAGG - Intergenic