ID: 1181420654

View in Genome Browser
Species Human (GRCh38)
Location 22:22795840-22795862
Sequence GACAGCTGTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181420649_1181420654 16 Left 1181420649 22:22795801-22795823 CCCTGCCATCCTCTACAGATAAC 0: 1
1: 14
2: 210
3: 225
4: 275
Right 1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG No data
1181420652_1181420654 7 Left 1181420652 22:22795810-22795832 CCTCTACAGATAACTACTCTGCT 0: 1
1: 1
2: 8
3: 32
4: 172
Right 1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG No data
1181420650_1181420654 15 Left 1181420650 22:22795802-22795824 CCTGCCATCCTCTACAGATAACT 0: 1
1: 13
2: 215
3: 220
4: 260
Right 1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG No data
1181420651_1181420654 11 Left 1181420651 22:22795806-22795828 CCATCCTCTACAGATAACTACTC No data
Right 1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181420654 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG Intronic
No off target data available for this crispr