ID: 1181422333

View in Genome Browser
Species Human (GRCh38)
Location 22:22810645-22810667
Sequence AAGGAGAGGCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5612
Summary {0: 1, 1: 5, 2: 65, 3: 687, 4: 4854}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181422333_1181422342 6 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422342 22:22810674-22810696 CGAGACTGACTCTGACTCATGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1181422333_1181422346 26 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422346 22:22810694-22810716 GGGGCAGCTCCTGTGCGCAGGGG 0: 1
1: 1
2: 2
3: 39
4: 574
1181422333_1181422345 25 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422345 22:22810693-22810715 TGGGGCAGCTCCTGTGCGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 323
1181422333_1181422341 5 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422341 22:22810673-22810695 TCGAGACTGACTCTGACTCATGG 0: 1
1: 0
2: 0
3: 9
4: 113
1181422333_1181422343 7 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422343 22:22810675-22810697 GAGACTGACTCTGACTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1181422333_1181422344 24 Left 1181422333 22:22810645-22810667 CCCTCCTCCCTCTGCCTCTCCTT 0: 1
1: 5
2: 65
3: 687
4: 4854
Right 1181422344 22:22810692-22810714 ATGGGGCAGCTCCTGTGCGCAGG 0: 1
1: 0
2: 2
3: 20
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181422333 Original CRISPR AAGGAGAGGCAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr