ID: 1181426796

View in Genome Browser
Species Human (GRCh38)
Location 22:22849002-22849024
Sequence TCAGCTCCCCAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181426796_1181426798 -8 Left 1181426796 22:22849002-22849024 CCAGCAGCATCCTGGGGAGCTGA No data
Right 1181426798 22:22849017-22849039 GGAGCTGAGCCCTCTACACTTGG 0: 1
1: 0
2: 2
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181426796 Original CRISPR TCAGCTCCCCAGGATGCTGC TGG (reversed) Intronic
No off target data available for this crispr