ID: 1181427314

View in Genome Browser
Species Human (GRCh38)
Location 22:22852057-22852079
Sequence CCCCATGTGCTCTTGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181427314_1181427317 15 Left 1181427314 22:22852057-22852079 CCAGGGAACAAGAGCACATGGGG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1181427317 22:22852095-22852117 ATGAATATAATTCTCTCTTGTGG No data
1181427314_1181427318 24 Left 1181427314 22:22852057-22852079 CCAGGGAACAAGAGCACATGGGG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1181427318 22:22852104-22852126 ATTCTCTCTTGTGGATGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181427314 Original CRISPR CCCCATGTGCTCTTGTTCCC TGG (reversed) Intronic
900461814 1:2805352-2805374 CCCGAGCTCCTCTTGTTCCCCGG + Intergenic
900550199 1:3250744-3250766 CCCCATGTGCTCTTGGACTTGGG - Intronic
902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG + Intergenic
904331452 1:29760561-29760583 CTCTATGTGCTCTTGCCCCCAGG + Intergenic
904633039 1:31857499-31857521 CCCTATGTGCTCTCATTTCCTGG - Intergenic
906673501 1:47677003-47677025 CACCATGTGCTTTTGTTCTTGGG + Intergenic
909763211 1:79320479-79320501 GCTTATGTGCTCTTGTTGCCGGG + Intergenic
909765372 1:79349353-79349375 CCTTATGTGCTCTTGTTGCCGGG + Intergenic
910121190 1:83792187-83792209 CCACATTTACTCTTGTTTCCAGG + Intergenic
912464977 1:109865982-109866004 CCATATCTGCTTTTGTTCCCTGG - Intergenic
917722772 1:177801929-177801951 CTTCATGTCCTCTTCTTCCCTGG + Intergenic
919830156 1:201535339-201535361 CCCCATGGACTCTTTCTCCCAGG + Intergenic
920020511 1:202952303-202952325 CTCCATGTGCAGTTGTTACCTGG - Intronic
921178030 1:212609855-212609877 GCCCATGTGCCCTTATTTCCCGG - Intronic
923293329 1:232568603-232568625 CTCCATGTCCTCTTGTACCCAGG - Intergenic
1064086161 10:12348510-12348532 GCCCACGTGCTCCAGTTCCCTGG - Intergenic
1069947781 10:71999556-71999578 CCCACTGTGCTCTTGGCCCCAGG + Intronic
1073096302 10:100982168-100982190 CCCCATGTCCTCTGCTTGCCTGG - Intronic
1073479729 10:103778924-103778946 CCCCAGGTGCTCTGCTGCCCTGG - Intronic
1074987108 10:118668438-118668460 CCCCAGGTCCTGATGTTCCCTGG - Intergenic
1075066838 10:119294501-119294523 CTCCAAATGCTCTTGTTCTCAGG + Intronic
1075107605 10:119551962-119551984 CCCCTTCTTCCCTTGTTCCCAGG - Intergenic
1075687972 10:124377216-124377238 CCCCATGCACTCTTGTCCCTTGG - Intergenic
1076070594 10:127485256-127485278 CCCTCTGTGCTCTGCTTCCCTGG + Intergenic
1077494971 11:2882590-2882612 CCCCATGTCCTCCTGATTCCAGG + Intergenic
1085204203 11:74720810-74720832 GCCCATGAGCTCCTGTTTCCTGG - Intronic
1088261448 11:107948011-107948033 CCCCATGTCCTCTTCACCCCTGG - Intronic
1088374564 11:109126000-109126022 CCCCCCGTCCTCTTGTTTCCAGG + Intergenic
1089339712 11:117749157-117749179 CCCCCTCTGCCCTGGTTCCCTGG + Intronic
1090733023 11:129588262-129588284 CCCCATTTGCTCTAGAGCCCTGG + Intergenic
1091129616 11:133134498-133134520 GCCCCTGTGCTCTTGTTTCCAGG + Intronic
1091663143 12:2399323-2399345 CCCCCTGTCCTCTTGGTGCCTGG + Intronic
1093199522 12:16170250-16170272 ACCCATGTGATCTTGTCCCCAGG - Intergenic
1093616862 12:21236195-21236217 GCCCATGTTCTCTTTGTCCCAGG + Intronic
1096673854 12:53215869-53215891 CCCCATGTGCATTTGTTCCTTGG + Intronic
1096802644 12:54121543-54121565 TCCCAGCTGCTCTTGTTGCCAGG - Intergenic
1101517657 12:105451719-105451741 TCCCTTGTGATCATGTTCCCAGG - Intergenic
1101957575 12:109224427-109224449 TCCCAGGTGGTCTTGCTCCCGGG + Intronic
1102392171 12:112558047-112558069 CCCCATGTGCTTCTATTCCAAGG + Intergenic
1106175574 13:27328066-27328088 CCCCCTCTGCTCTTTGTCCCAGG + Intergenic
1106792291 13:33167931-33167953 CCCCTAGTGCCCTGGTTCCCTGG - Intronic
1108537915 13:51405328-51405350 CCTCATGTACTCCTTTTCCCTGG - Intronic
1113377918 13:109782200-109782222 CCCCAGGAGCTCTTGTCTCCCGG + Exonic
1113674227 13:112196678-112196700 CCCCTAGTTCTCTGGTTCCCTGG + Intergenic
1113674266 13:112196822-112196844 CCCCTAGTTCTCTGGTTCCCTGG + Intergenic
1113674329 13:112197032-112197054 CCCCTAGTTCTCTGGTTCCCTGG + Intergenic
1113674393 13:112197250-112197272 CCCCTAGTTCTCTGGTTCCCTGG + Intergenic
1116574217 14:46552375-46552397 CCCCATGGGGTCCTATTCCCTGG + Intergenic
1117481347 14:56148499-56148521 GCCCATGTGCTCTTGCTTCCAGG + Intronic
1118202743 14:63692204-63692226 CCCATTTTGCTCTTGTCCCCAGG + Intronic
1119407535 14:74407833-74407855 CCCCAGGTGCTCTTACCCCCTGG + Exonic
1119850318 14:77862040-77862062 CCTCATGTCCTCTAATTCCCAGG + Intronic
1120815405 14:88851861-88851883 CCCCATCTTCTCTTGCTCCAGGG - Intronic
1122777882 14:104130801-104130823 ACCCAGGTGTTCTTCTTCCCCGG + Intergenic
1202901744 14_GL000194v1_random:47711-47733 CCCCAGGTACTCTCTTTCCCAGG - Intergenic
1125253396 15:37732889-37732911 TCTCATGTCCTCTGGTTCCCAGG + Intergenic
1127490366 15:59456533-59456555 CCCCATGTGCTTTTTTTCACAGG + Intronic
1128590198 15:68888585-68888607 CCCCAAAAGCTCTTTTTCCCAGG - Intronic
1131253420 15:90845673-90845695 CCCCCCATGCTCTTGGTCCCAGG - Intergenic
1132926699 16:2433480-2433502 TCACATGTGCTCATGGTCCCAGG + Intronic
1133701236 16:8311169-8311191 TCCCATGAACTCCTGTTCCCCGG + Intergenic
1135185791 16:20314701-20314723 CCCCTTCTGTTCTTGTTCACAGG - Exonic
1135644435 16:24149108-24149130 CTTCATGGGGTCTTGTTCCCTGG + Intronic
1139583593 16:67887047-67887069 CACCACATGCTCTTGTTCCACGG - Intronic
1141729167 16:85810297-85810319 CCCCAGGTGCTCACTTTCCCAGG + Intergenic
1143967186 17:10764481-10764503 TCTCGTGTGCTCTTGTCCCCTGG + Intergenic
1144130641 17:12243337-12243359 CCCCATGTCCTCTTCTGCCCTGG + Intergenic
1145216596 17:21057276-21057298 TCCCCTGTTCCCTTGTTCCCTGG + Intergenic
1147375542 17:40020482-40020504 CCCTTTGTGCTCTTGATCTCAGG - Intronic
1147598897 17:41733976-41733998 CCTCCTCTGCTCTTGTCCCCTGG - Intronic
1147755671 17:42765939-42765961 CCCCATGTCCTCATTTTCTCAGG - Intergenic
1151764059 17:76122948-76122970 CCCAGTGTGCTCTTGTTCTGTGG + Intergenic
1153512990 18:5875809-5875831 CCTCAAGGGCTCTTGTTCTCTGG + Intergenic
1157590104 18:48831399-48831421 CCCCATGGGCTCTTGGTCCAGGG - Intronic
1160395149 18:78565044-78565066 CTCCACGTGCTCTTCATCCCAGG - Intergenic
1161006027 19:1937272-1937294 CCCCATGTGCTCCTCCTCCTGGG + Intergenic
1162372126 19:10285939-10285961 CCCCATTTGATCTTTTTGCCAGG - Exonic
1162822292 19:13230221-13230243 CCCCATTCTCTCTTGGTCCCCGG - Intronic
1163845850 19:19637743-19637765 CCCCATGAGGTCCTGTCCCCTGG - Intronic
1164474175 19:28562481-28562503 CCTCATGTCCTTTGGTTCCCGGG + Intergenic
1166416903 19:42601874-42601896 CCCCACCTGCTCTCGTTCCAGGG + Intronic
1166778137 19:45324589-45324611 CCCCATCTGCTCCAGTCCCCTGG - Intergenic
1166953714 19:46447889-46447911 CCCCAGGCACTCTGGTTCCCCGG + Intergenic
925238929 2:2304901-2304923 CCACATGGGCTCTTGAGCCCTGG + Intronic
928572168 2:32620540-32620562 CCGCATGTGCTCTTGGACCCAGG - Intergenic
929419072 2:41772577-41772599 GCCCATGGACTCTTTTTCCCAGG + Intergenic
929648888 2:43657604-43657626 TCCCATGTGCTCTTTTTCCATGG - Intronic
933693077 2:85194643-85194665 CCCCAGGTGCCCTTGAGCCCAGG + Intronic
934561999 2:95318184-95318206 CCCCATCTGCTCTCCCTCCCTGG - Intronic
934603912 2:95679887-95679909 CCTCATGTGGTCTGGCTCCCTGG + Intergenic
935756537 2:106280450-106280472 CACCATCAGCTGTTGTTCCCTGG - Intergenic
936009588 2:108916918-108916940 CCCCATGTCCTCCTGCTCCTTGG - Intronic
936508499 2:113127330-113127352 TCCATTGTGCTCTTCTTCCCAGG + Intronic
936537296 2:113322116-113322138 CCTCATGTGGTCTGGCTCCCTGG + Intergenic
936644580 2:114354460-114354482 TCCCAGGTGTTCTTATTCCCTGG + Intergenic
938062331 2:128263211-128263233 CCACATCTGCCCTTGCTCCCGGG - Intronic
939303685 2:140381415-140381437 CCCCATCTACTCTTGGTCCAGGG - Intronic
940118133 2:150233099-150233121 CCACATGTGATCATCTTCCCAGG - Intergenic
941779405 2:169427612-169427634 CCCCATGTTCTCTTGGACGCTGG - Intergenic
942154928 2:173118506-173118528 CTCCAAGTGCTCATGTTCTCAGG - Intronic
942380172 2:175382433-175382455 CCCCATGTTGTAATGTTCCCAGG - Intergenic
946241258 2:218357359-218357381 CCCCATGTCCCCATGTCCCCGGG - Intronic
946305692 2:218855821-218855843 CCCCCTGGGTTCTTGCTCCCCGG + Intergenic
947707024 2:232284646-232284668 CCCCATGTGGTCTTTGCCCCGGG + Intronic
947971278 2:234327517-234327539 CATCAGGTGCTCTTGTTCTCAGG - Intergenic
948213328 2:236210984-236211006 TCCCATGTGATCTTTTTCCAAGG - Intronic
1169560097 20:6790561-6790583 CCCCAAGTGCTTTTTTCCCCTGG - Intergenic
1170357120 20:15505253-15505275 CACCATGTGTTCGTTTTCCCAGG + Intronic
1171794104 20:29553044-29553066 TCCCAGCTGCTCTTGTTGCCAGG + Intergenic
1171892689 20:30730139-30730161 CCCCAGGTACTCTCTTTCCCAGG + Intergenic
1174365756 20:50055259-50055281 GCACTTGTGCTCTTGTGCCCTGG + Intergenic
1175825070 20:61932224-61932246 CCCCATGTCCTCCCGTCCCCAGG + Intronic
1176621112 21:9062478-9062500 CCCCAGGTACTCTCTTTCCCAGG - Intergenic
1179086654 21:38224452-38224474 CCCCATGTGCTGCTATACCCTGG - Intronic
1179087446 21:38229813-38229835 CCCCGTGTGCTATTGTATCCTGG - Intronic
1179393079 21:41011363-41011385 CCCCAGGTCCTTTTGTTCACAGG + Intergenic
1180064131 21:45404580-45404602 CCCCAGGTCCCCCTGTTCCCAGG - Intergenic
1181335570 22:22125550-22125572 CCACATCTGCTGTGGTTCCCTGG + Intergenic
1181427314 22:22852057-22852079 CCCCATGTGCTCTTGTTCCCTGG - Intronic
1183774966 22:39958081-39958103 CCCCATGGGCTGTAGCTCCCAGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184241546 22:43213493-43213515 CCCCATGAGCCTTTCTTCCCAGG - Intronic
953905760 3:46867601-46867623 CCCCACGTGCCCTTGTCCCCTGG + Intronic
954731873 3:52670644-52670666 CCCCATTTTCCCTTCTTCCCAGG + Intronic
954810113 3:53242368-53242390 AGCCACGAGCTCTTGTTCCCTGG + Intronic
954954632 3:54508374-54508396 GCCCATGTGCTGTTCTTCTCTGG - Intronic
961091219 3:124114296-124114318 TACCATGAGCTCTTTTTCCCAGG + Intronic
961344181 3:126251156-126251178 CCCCATGGGCACATGTTCTCAGG + Intergenic
961650659 3:128415279-128415301 CTGCATGTCCTCTTGTGCCCTGG - Intergenic
963040336 3:141065478-141065500 ACCCAGGTGCTTTTGATCCCAGG - Intronic
964366665 3:155957850-155957872 CACCATGGGCTCCTGTTCTCAGG + Intergenic
968511635 4:998193-998215 CCCCACCTGCTCCTGTACCCCGG - Intronic
969942145 4:10743583-10743605 CCACTTCTGCTCTTATTCCCTGG - Intergenic
971986456 4:33831062-33831084 CTCCATGTGCCCTTGTTTCATGG - Intergenic
972372872 4:38442417-38442439 CCCCCTGAGCTCTTATTACCTGG - Intergenic
974975417 4:68885825-68885847 CCCCAGGTGCTCTCTGTCCCAGG - Intergenic
975288075 4:72643809-72643831 ATCCATGTGCTCTTCTTTCCTGG + Intergenic
976955215 4:90888235-90888257 CCCCATGTGCTGTTTCTCACTGG - Intronic
979740923 4:124149842-124149864 CCTCACCTGCTCTTTTTCCCTGG + Intergenic
982219216 4:153110747-153110769 CCCCATCTCCTCTTGATCCCTGG - Intergenic
985654858 5:1125189-1125211 CTCCATGTGCTGCAGTTCCCAGG - Intergenic
985728528 5:1528686-1528708 CCACAGGTCCTCTTGTACCCTGG - Intergenic
986004535 5:3657012-3657034 TCCCATGCTCTCTTGTTCCTGGG + Intergenic
987111584 5:14692832-14692854 ACCCGTTTGCTCTTCTTCCCAGG + Exonic
989564127 5:42884571-42884593 CCACATGTGCTATTTTCCCCTGG - Intronic
992160196 5:73993507-73993529 CTCCTTCTGCTCTTCTTCCCTGG + Intergenic
996247866 5:121287096-121287118 CCAAATGTGGTCTGGTTCCCAGG - Intergenic
996387616 5:122925347-122925369 CCCCCTGGGCTCTAGCTCCCTGG + Intronic
997432621 5:133851245-133851267 CCCCCTGTCTTCTGGTTCCCTGG - Intergenic
999571753 5:152926594-152926616 CCCCTAGTGCTCTTCTTCTCAGG + Intergenic
1006780054 6:36626511-36626533 CCAGACGTGCCCTTGTTCCCTGG - Intergenic
1007125483 6:39422543-39422565 CCACATGTGTTCCTGATCCCTGG + Intronic
1008037298 6:46759063-46759085 CCACATGGGCTGTTGTTTCCTGG + Exonic
1009203154 6:60770215-60770237 TCACTTGTGCTCTTGTGCCCAGG + Intergenic
1015011147 6:128349977-128349999 CCATATGTGCTATTCTTCCCGGG - Intronic
1015885375 6:137912170-137912192 CCCCTTGAGCTCTTCTTCTCTGG + Intergenic
1016204067 6:141451892-141451914 GCTCCTGTGCTTTTGTTCCCTGG - Intergenic
1017774881 6:157672938-157672960 GCCCATGTGCTCATCTTTCCGGG - Exonic
1018074768 6:160201895-160201917 TCCCAGGTTCCCTTGTTCCCAGG - Intronic
1025273092 7:57544034-57544056 CTCCCTGTGCCCTTGTTTCCTGG - Intergenic
1027159432 7:75791521-75791543 CCCCATCTGCTGTGGTTCCCAGG + Intergenic
1029308965 7:99643648-99643670 CCCCATCTGCTGTTGCTCCTTGG - Intergenic
1030057625 7:105597297-105597319 CCCCATGCCCTTCTGTTCCCTGG + Intronic
1030208330 7:106972408-106972430 CTCCAAGTGGTCTTGTTACCGGG + Intergenic
1031543740 7:123027361-123027383 CCCCTTTTTCTCTTGTTGCCTGG + Intergenic
1032475500 7:132208877-132208899 CTGTTTGTGCTCTTGTTCCCAGG + Intronic
1032519860 7:132535675-132535697 ACCCAGGTCCTTTTGTTCCCAGG + Intronic
1033471085 7:141649831-141649853 CACCATGTCCTCCTATTCCCAGG + Intronic
1034481104 7:151320943-151320965 CTCCATGTGCTCTTGGGGCCTGG + Intergenic
1034931959 7:155169746-155169768 CCCCATGTGATCTGGTGTCCTGG - Intergenic
1035634834 8:1136753-1136775 CCCCGTGTGCTCCTGCTCCCTGG - Intergenic
1036532237 8:9602464-9602486 TCCCATCCTCTCTTGTTCCCAGG + Intronic
1036656876 8:10682518-10682540 CCCTCTGTGCACCTGTTCCCTGG + Intronic
1041127776 8:54662512-54662534 TCCAATGTGCTCTTCTTCCTAGG + Intergenic
1041128247 8:54667151-54667173 TCCCGTGTGCTCCTCTTCCCAGG - Intergenic
1041456074 8:58061736-58061758 TCCCATGTGCTCCTTCTCCCAGG + Intronic
1041956709 8:63564307-63564329 CCCCATTTTCTTTTGTTCCTAGG + Intergenic
1042119393 8:65468451-65468473 CCCCTTGTACTTTTGTACCCTGG + Intergenic
1042511898 8:69620580-69620602 CCTCATGTGCCATTCTTCCCTGG + Intronic
1044598302 8:93979680-93979702 CTTCATGGGCTCTTGTCCCCAGG + Intergenic
1047185752 8:122631755-122631777 CCCCATGAGTTCTGTTTCCCTGG - Intergenic
1048282678 8:133116587-133116609 CCCCATGTTCTCTTTTCACCAGG + Exonic
1049960655 9:734978-735000 CATCATGTGGTCTTGCTCCCTGG + Intronic
1050712938 9:8486342-8486364 TCCCATGTGCTCCAGTTCCAGGG - Exonic
1052336345 9:27324223-27324245 CCCCAAGTGCTCCTGTCCCAAGG + Intergenic
1052628362 9:31005247-31005269 CCCCAGGTGCTCTTCTCCCAGGG - Intergenic
1056313719 9:85368667-85368689 CCCCATGTGCCCCTGCACCCTGG + Intergenic
1056885202 9:90435506-90435528 CCCTATGTGCTCCCATTCCCAGG - Intergenic
1058933529 9:109746204-109746226 TCCACTGTGCTCTTGGTCCCAGG + Intronic
1059998704 9:119938964-119938986 CCCCAGGTCCTCTTTTCCCCAGG - Intergenic
1061888080 9:133603034-133603056 CCCCAGGTGCCCTTTCTCCCTGG - Intergenic
1062287706 9:135780488-135780510 CCCTATGGGCTCTTGGTCCACGG - Intronic
1062348480 9:136127021-136127043 CCCCTTGGGCTCATGTTCACAGG - Intergenic
1062618838 9:137410611-137410633 CCCCAGAGGCTCTTGTTCCCTGG + Intronic
1203744326 Un_GL000218v1:32947-32969 CCCCAGGTACTCTCTTTCCCAGG - Intergenic
1203565782 Un_KI270744v1:86537-86559 CCCCAGGTACTCTCTTTCCCAGG + Intergenic
1185657062 X:1694033-1694055 CGGCCTGTGCTTTTGTTCCCTGG - Intergenic
1191937929 X:66444975-66444997 CCTAATGTTCTCTTATTCCCAGG + Intergenic
1195577460 X:106467668-106467690 TCCCAGATGCTCCTGTTCCCAGG + Intergenic
1199644550 X:149893724-149893746 CATCCTGTGCTCTCGTTCCCTGG + Intergenic
1200432683 Y:3106508-3106530 CCCCATCATCTCTTGTTCACTGG + Intergenic
1201157651 Y:11147934-11147956 CCCCAGGTACTCTCTTTCCCAGG - Intergenic
1202096253 Y:21250908-21250930 CCCCATGTGCTCTTTTTCCACGG + Intergenic