ID: 1181428339

View in Genome Browser
Species Human (GRCh38)
Location 22:22858460-22858482
Sequence ATCCAGGAAGGCTCTACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181428330_1181428339 23 Left 1181428330 22:22858414-22858436 CCAGCTCAGCTGGATGTGTGACC 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1181428329_1181428339 24 Left 1181428329 22:22858413-22858435 CCCAGCTCAGCTGGATGTGTGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1181428336_1181428339 -8 Left 1181428336 22:22858445-22858467 CCTTTCACTCTAGTCATCCAGGA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1181428333_1181428339 1 Left 1181428333 22:22858436-22858458 CCCGAGGCACCTTTCACTCTAGT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1181428334_1181428339 0 Left 1181428334 22:22858437-22858459 CCGAGGCACCTTTCACTCTAGTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1181428332_1181428339 2 Left 1181428332 22:22858435-22858457 CCCCGAGGCACCTTTCACTCTAG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181428339 Original CRISPR ATCCAGGAAGGCTCTACAGA GGG Intronic
902094136 1:13928661-13928683 ATCCAGCAAGGCTCTGCATGGGG + Intergenic
902101285 1:13991928-13991950 ATCCAGGAAGACGATAAAGACGG - Intergenic
903282738 1:22259245-22259267 ATTCTGGAAGGCTCTAGAGAAGG + Intergenic
903381884 1:22902885-22902907 ATCCAGGCAGTCTTCACAGAGGG + Intronic
909686148 1:78351183-78351205 CCCAAGGAAGGCTTTACAGAAGG + Intronic
912139960 1:106712826-106712848 GTGCAGGATGGCTCTCCAGATGG + Intergenic
915463054 1:156081246-156081268 ATCCAGGGAGGCTGTCCTGAGGG - Intronic
916515025 1:165508226-165508248 CTCCAGGAAGGCTCTTTAAAGGG - Intergenic
916844987 1:168641539-168641561 AACCAGGAAGGTTCCAGAGAAGG - Intergenic
916930151 1:169569138-169569160 CTCAAGGAAGTCTCTACATAAGG + Intronic
918410057 1:184249212-184249234 ATACAGGCAGCCTCTAAAGATGG - Intergenic
920362209 1:205426807-205426829 ATCCTGGAGGCCTCTAAAGAAGG + Intronic
921624256 1:217360681-217360703 TTCCAGGAAGTCTCTTTAGAAGG + Intergenic
921999667 1:221463528-221463550 ATCATGGAAGGCTCCGCAGATGG + Intergenic
1063702620 10:8400280-8400302 AGCCAGGATGGCTCTGCAGCTGG - Intergenic
1067550398 10:47230376-47230398 GTGCTGGGAGGCTCTACAGAAGG + Intergenic
1068680198 10:59811016-59811038 ATCCAGGCAGCCTCTAGAGCTGG + Intronic
1068933427 10:62614002-62614024 TTCCAGGAAAGCTCTGTAGAAGG + Intronic
1070467687 10:76740833-76740855 TTCCAGGAAGGTTTTACATATGG - Intergenic
1073562596 10:104509705-104509727 ATCCAGAAAGGCTAAAGAGAAGG + Intergenic
1074052040 10:109888754-109888776 ATCCTGGAAGGCTACAGAGAGGG + Intronic
1074453463 10:113577985-113578007 GGCCAGGAAGGCTCTTCAGAAGG - Intronic
1075311666 10:121419571-121419593 ATGCAGGGCTGCTCTACAGAGGG + Intergenic
1075947895 10:126453988-126454010 ATCCAGGGAGGCTCTGAAGCTGG + Intronic
1077004239 11:344269-344291 ATCCAGGAGGGATCTACTGGTGG + Intergenic
1077435873 11:2538977-2538999 CTCCAGGGAGGCTGTGCAGAGGG + Intronic
1078094072 11:8285788-8285810 ATCCAGGAAGAATCTACTAAAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081654280 11:44847114-44847136 ATCCAGGAAGGCTTCAGGGATGG + Intronic
1083193479 11:61068957-61068979 GTCCAGGAAGGCTCCACCCAAGG - Intergenic
1085627224 11:78082698-78082720 CTCCAGGAAGGTATTACAGACGG + Intergenic
1088725315 11:112629406-112629428 ATGCAGGGAGGCTCTAGCGAAGG - Intergenic
1090139412 11:124238753-124238775 ATACAGCAAGGGGCTACAGATGG - Intergenic
1090365212 11:126199780-126199802 ACCCAGGAAGGCACCACAAAGGG - Intergenic
1092922566 12:13245702-13245724 ATGGAAGAAGGCTCTACAGCAGG - Intergenic
1094244915 12:28278415-28278437 AGGCAGGAAGGCTCCAAAGAAGG - Intronic
1095458742 12:42418601-42418623 ATCAAGAAAGGCTCTCAAGAAGG - Intronic
1096512415 12:52138386-52138408 ATCCAGAAAGGCTGCTCAGAGGG - Intergenic
1097088647 12:56488091-56488113 CTCCATGAAGGCTCTGCAGAAGG - Exonic
1099488212 12:83254087-83254109 AATCAGGAAGGCTTAACAGAGGG + Intergenic
1103023437 12:117554906-117554928 GTCCAGGAAGGCACAACGGATGG - Intronic
1105246125 13:18651907-18651929 ATCCAGAAAGGGTCTAGTGAGGG - Intergenic
1111279179 13:85996446-85996468 ATTCAGGAATGCACTACAAATGG - Intergenic
1114557021 14:23567865-23567887 ATTCAGGAAGGCTCTGCAGTCGG - Exonic
1114853968 14:26415047-26415069 ATCCAGGAAGTCTCTGTGGATGG + Intergenic
1116197480 14:41747863-41747885 ATCCAGAAAAGATATACAGATGG + Intronic
1118534937 14:66751687-66751709 ATCCTGCAGGGCTCTACAAATGG - Intronic
1122907598 14:104808901-104808923 AACCAGGAGGGTTCCACAGAGGG - Intergenic
1124364819 15:29063982-29064004 ATTCAGGAGGGCCCTGCAGAGGG - Intronic
1126569707 15:50137350-50137372 ATTCTGGAAGGCTCTTCAGAGGG + Intronic
1127091088 15:55468485-55468507 AACCAGGAAGAATCTACACATGG + Intronic
1129600041 15:76993483-76993505 ATCAAGGAAGGCTTGCCAGAAGG + Intronic
1129650804 15:77487142-77487164 TTCCAGGAAGACTCTTTAGAGGG - Intergenic
1131068853 15:89451403-89451425 ATCCAGGGAGGCGCTGCAGATGG + Intergenic
1131143395 15:89996342-89996364 ATCCTGGAAGGGTCTGCAGCAGG + Intergenic
1132771402 16:1565453-1565475 ATCCAGGGGGGCTGGACAGAAGG + Intronic
1134192799 16:12135439-12135461 ATCCATGAGGGCTTTACAGGAGG + Intronic
1137745988 16:50820540-50820562 ATCAGGGAAGGCTATACAAAGGG - Intergenic
1140018613 16:71214733-71214755 ATCCTATAAGGCTCTTCAGAGGG + Intronic
1140971712 16:80019869-80019891 CTCCAGCAAGGGTCTACAGGGGG - Intergenic
1142184589 16:88688533-88688555 ACCCAAGAAGGCCCCACAGAGGG + Intergenic
1144638794 17:16926555-16926577 CTTGAGGAAGGGTCTACAGAGGG - Intergenic
1146917644 17:36688301-36688323 ATCCAGGACTGCTACACAGAAGG - Intergenic
1147302807 17:39543376-39543398 ATCCAGGAGGGGTCTAAAGAGGG - Intronic
1147493674 17:40895637-40895659 AGCCAGGAAGGCTTTCTAGAGGG + Intergenic
1148769199 17:50057099-50057121 ATCCAGTCTGGCTCTGCAGAGGG - Intronic
1150198839 17:63332055-63332077 ATTCAGGAAGACTCTACAGATGG - Intronic
1150484332 17:65533363-65533385 ATCCAGGGAGGCTGTTCAGGTGG + Intronic
1154442792 18:14407758-14407780 ATCCAGAAAGGGTCTAGTGAGGG + Intergenic
1155605415 18:27600255-27600277 ATCCAGGAAGCCTCTTAGGATGG + Intergenic
1155787381 18:29917548-29917570 ATCCTGGAAAGCTCTAGAAAGGG - Intergenic
1156070074 18:33196380-33196402 GTCCAGGAAGGGTCTAAATACGG - Intronic
1156556421 18:38073829-38073851 ATCCAGGAGAGATCTAGAGAAGG - Intergenic
1156891535 18:42195807-42195829 CTACAGGAAGGCTCCAGAGAAGG + Intergenic
1158419219 18:57278189-57278211 CTCCAGGAAGGCACAAGAGAGGG - Intergenic
1159997211 18:74977625-74977647 ATCTTGGCAGGCTCCACAGAAGG + Intronic
1160240095 18:77117486-77117508 ATCCAGGAAGGCTTTTCACAAGG + Intronic
1161324507 19:3656946-3656968 CTCAGGGAAGGCTCCACAGATGG + Intronic
1161474265 19:4475435-4475457 TCCCAGGAAGGCTCTGGAGAAGG - Exonic
1164313109 19:24063570-24063592 ATCCTGGACCGGTCTACAGAGGG + Intronic
1164567834 19:29340658-29340680 ATCCATGTAGCATCTACAGAAGG - Intergenic
1164680269 19:30129938-30129960 ATCCAAGAAGGCCCTTCATAAGG + Intergenic
1166251744 19:41576206-41576228 CTCCAGGAACGCTCTAGACAGGG - Intronic
1166486694 19:43220131-43220153 AGCCAAGAATGCTCTACTGATGG + Intronic
926619758 2:15036936-15036958 AGCCAGGAAGGTTCTAGAAAAGG + Intergenic
926745242 2:16151438-16151460 GTCCAGGAAGGTTCTGCAGTGGG + Intergenic
926977590 2:18530840-18530862 CTCCAGGAAGGCTTTTCATACGG + Intergenic
927996050 2:27487281-27487303 AATCAGGAAGGCTTCACAGAGGG - Intronic
929944658 2:46361304-46361326 CACCAGGAAAGCTCTGCAGATGG - Intronic
935417970 2:102838472-102838494 GTCAGGGAAGGCTCTTCAGAGGG + Intronic
935692035 2:105740652-105740674 AACCAGGAAGGGGCTAGAGAGGG + Intergenic
935794956 2:106632015-106632037 GTGCAGGAAGGCTCCACTGACGG + Intergenic
936271756 2:111054512-111054534 CCCCAGGAAGGCTCCACTGATGG + Intronic
936460369 2:112709929-112709951 GACCAGGAAGTCTCTACTGAAGG - Intergenic
939714467 2:145566566-145566588 ATCAAGGAAGTATTTACAGAGGG + Intergenic
941018646 2:160385235-160385257 ATCCAGGAGGGCTCCGCCGAGGG + Intronic
941277787 2:163512772-163512794 AACCAGAAAGGCTCTACACTGGG + Intergenic
946352442 2:219164128-219164150 ATCCAGGAAAGCTATTTAGAAGG + Intronic
946882421 2:224190029-224190051 ATCCAGGAAGTCTGAACAAAAGG - Intergenic
947618809 2:231575777-231575799 GCCAAGGAAGGCTCTGCAGACGG + Intergenic
948564656 2:238876217-238876239 ACCCAGGCAGCCTCTGCAGAGGG + Intronic
948771454 2:240253207-240253229 ATTCAGAAAGGCTTTCCAGAAGG + Intergenic
1172834675 20:37865363-37865385 ATCCAGGGAAGCTGTACGGAAGG + Intronic
1173569576 20:44067677-44067699 ATCCAGGAAGACTTTCTAGAGGG - Intronic
1175127415 20:56762873-56762895 TTCCAGGAAGGCGACACAGAGGG - Intergenic
1178607133 21:34048278-34048300 ATCCATCAAGGCTCTGCACAAGG - Intergenic
1179436780 21:41367859-41367881 ATCCAGGAGGGAGCTACTGAGGG - Intronic
1181402846 22:22661734-22661756 CTCCAGGCAGGCTGTGCAGAGGG + Intergenic
1181407518 22:22695229-22695251 CTCCAGGCAGGCTCTGCAGAGGG + Intergenic
1181409013 22:22704977-22704999 GTCCAGGTTGGCTCTGCAGAGGG + Intergenic
1181411250 22:22721314-22721336 CTCCAGGTAGGCTCTGCAGAAGG + Intergenic
1181415513 22:22755995-22756017 CTCCAGGCAGGCTCTGCAGAGGG + Intronic
1181419768 22:22789630-22789652 CTCCAGGCAGGCTCTGAAGAGGG + Intronic
1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG + Intronic
1182504504 22:30772157-30772179 ATCCATCCAGGCTCTCCAGAGGG - Intronic
1183365380 22:37403994-37404016 GTCCAGGAAGGCTTTGCTGAGGG + Intronic
1183508588 22:38222466-38222488 AAGCAGGCAAGCTCTACAGAGGG + Intronic
1183719947 22:39557025-39557047 CTCCAGGAAGGCTTCTCAGAGGG - Intergenic
1184460479 22:44635015-44635037 ACTCAGGAAGCCTCTGCAGAAGG - Intergenic
951454495 3:22875002-22875024 ATCAAGCAAAGCTCCACAGAGGG + Intergenic
951682697 3:25311102-25311124 ATCAAGGAAGGCTTCATAGAGGG + Intronic
952130264 3:30353935-30353957 ACCATGGAAGGCTCTTCAGAGGG - Intergenic
955228076 3:57077548-57077570 GACCAGGAAAACTCTACAGATGG + Intronic
957991241 3:87630417-87630439 ATCAAGGCAGTCTGTACAGAAGG - Intergenic
960016800 3:112900172-112900194 CTCCAGGAAGACTCTAGAGTGGG + Intergenic
960022533 3:112971367-112971389 ATCCAGGGATGCAATACAGAGGG + Intronic
960970819 3:123138934-123138956 ATCCAGGAAAGCCCTATAGCTGG + Intronic
964898362 3:161625893-161625915 ACCCAGGAAGACTATTCAGAAGG - Intergenic
966298538 3:178452294-178452316 ATCAAGGAAGGCTTCACAAAGGG + Intronic
966467868 3:180251989-180252011 GTCCAGGCAGCCTCTACAGTTGG - Intergenic
967088835 3:186117934-186117956 GTCAAGGAAGGCTTTAGAGAGGG + Intronic
967481204 3:189975336-189975358 CTCCAGATAGGCTCTTCAGAGGG + Intronic
968892623 4:3378618-3378640 TTCCAGAGAAGCTCTACAGATGG + Intronic
968934396 4:3602401-3602423 ATTCAGGCAGGGTCTCCAGACGG - Intergenic
971960265 4:33477530-33477552 ATCCAGAATGTCTCTACAGATGG - Intergenic
972562136 4:40238247-40238269 GTCAAGGAAGGCTTTCCAGAAGG + Intronic
975064422 4:70042870-70042892 CTCCAAGAAGGCTCAAAAGATGG + Intergenic
976919647 4:90423094-90423116 ATCTATGAATGCTCTACATATGG - Intronic
981116034 4:140992616-140992638 ATCCAGGAAAGCTTCACTGAGGG - Intronic
982483368 4:155938031-155938053 ATCCATGGAGGATCTACAAAAGG - Intronic
985300249 4:188480888-188480910 ATCCAGGAAGACTACCCAGAAGG - Intergenic
987379557 5:17272344-17272366 AGGCAGGAAGGCACCACAGAGGG - Intronic
989301463 5:39899100-39899122 ATCAAGGAAGGCTCTACTTCAGG - Intergenic
990240611 5:53812785-53812807 ATCTAGGAGGGCTCAACAGAGGG + Intergenic
991699038 5:69299979-69300001 ATGCAGGAAAGCTGAACAGAAGG - Intronic
993440224 5:87947662-87947684 AACGATGAAGGCTCTACAAATGG - Intergenic
995020672 5:107363898-107363920 AATAAGGAAGGCTCAACAGATGG - Intergenic
995805101 5:116042705-116042727 ATCCAGGGAGGGGCTACAGTAGG - Intronic
999429276 5:151512107-151512129 ATCCCAGAAGGCTCTTCAGGTGG - Intronic
1004601060 6:17150334-17150356 ACCCAGGAAATCTCAACAGATGG + Intergenic
1005634833 6:27743638-27743660 ATCCAGGAAGGCTTTCCGCAGGG - Intergenic
1010864423 6:80956660-80956682 TTGCAGGAAGGATCTACTGATGG + Intergenic
1015841605 6:137482994-137483016 TCCCAGGAAGGCAGTACAGAGGG - Intergenic
1016940452 6:149479019-149479041 ATTCAGCATGGCTCTAGAGAAGG - Intronic
1018243168 6:161798443-161798465 ATCCAGAAAGTCTCTGGAGATGG - Intronic
1018534418 6:164805329-164805351 ATCCAGGTAAGGTCTCCAGAGGG - Intergenic
1019288985 7:240822-240844 CTCCAGGAAAGCCCCACAGAGGG + Intronic
1021238871 7:18176288-18176310 ATCCAGGAATGCCGTACAAATGG + Intronic
1021431372 7:20562117-20562139 CTCAATGAAGGCTCCACAGAGGG - Intergenic
1021604607 7:22397442-22397464 CTCCAGGAAGCCTCCTCAGATGG + Intergenic
1021740649 7:23681900-23681922 ATCCAGGAAAACTCTTCGGAAGG - Intronic
1026666016 7:72340409-72340431 ATCCATGAAAGCTCTACATTTGG - Intronic
1029298774 7:99562044-99562066 TTCCAGGCAAGGTCTACAGATGG - Intronic
1029675241 7:102064168-102064190 AACCAGGACGGATCTAGAGACGG - Intronic
1030678577 7:112409848-112409870 ATCAAGGAAGACTTTACTGAAGG - Intergenic
1032192860 7:129774426-129774448 ATTCAGGATGGCCCTACAGATGG + Intergenic
1037580935 8:20245713-20245735 AACCAAGAAGGCTGGACAGATGG + Intergenic
1037934907 8:22909079-22909101 ATGCAGGAAGGCATTGCAGAGGG - Intronic
1040276890 8:46018406-46018428 TTCCAGGCAGGCTCTGCACATGG - Intergenic
1042495780 8:69453316-69453338 ATACAGGAATGCACTACAGGTGG + Intergenic
1044191795 8:89327557-89327579 ATCCCGGAAGGCACTAGTGAAGG - Intergenic
1044868842 8:96598698-96598720 ATCAAGGAAGGCTTCAGAGAGGG + Intronic
1045032138 8:98147383-98147405 AACCAGGAAGACTCTACAAGTGG + Intronic
1046096792 8:109572149-109572171 ATCCAGGAAGAGTGTAGAGAAGG - Intergenic
1046108658 8:109695126-109695148 CTCCAGAAAGCCTCTACAGTGGG - Intergenic
1047354400 8:124106663-124106685 ACCCAGGAAGGCTTCTCAGAGGG - Intronic
1049501789 8:142971176-142971198 CTCCTGCAAGGCTCTGCAGAGGG + Intergenic
1054455757 9:65429573-65429595 ATTCAGGCAGGGTCTCCAGAGGG + Intergenic
1059953731 9:119494551-119494573 ATCTAGGAAGGCTCTCGAAAAGG - Intergenic
1059992286 9:119876527-119876549 AGCCAGGGAAGCTATACAGAGGG + Intergenic
1062355348 9:136159413-136159435 CTCCACCACGGCTCTACAGACGG - Intergenic
1187341975 X:18429374-18429396 ATGCAGTAAGGCTCAATAGATGG - Intronic
1188106043 X:26148191-26148213 ATTCAGGAAGATACTACAGATGG - Intergenic
1188989689 X:36802549-36802571 ATCCAGGATGGAACAACAGATGG - Intergenic
1192178840 X:68902864-68902886 ATCTAGGGAAGCTCTACAGAAGG + Intergenic
1196178569 X:112666389-112666411 ATCAGGGAAGGCTTCACAGAAGG + Intronic
1196941153 X:120777264-120777286 ACACAGGAAGGCACTAAAGAGGG + Intergenic
1198271612 X:135061031-135061053 ATCCTGGAAGACTCAACAGTAGG + Intergenic
1200367575 X:155683790-155683812 ATTCAGGAAGAATATACAGAAGG + Intergenic